ZNF764 cdna clone
ZNF764 cDNA Clone
Synonyms
ZNF764; ZNF764 cDNA Clone; ZNF764 cdna clone
Sequence
atggcgccgcctctggccccgctccctccccgggacccaaacggggccggacccgagtggagggagccgggggctgtgagcttcgcggacgtggccgtgtacttctgccgggaggagtggggctgcttgcggccagcgcagagggccctgtaccgggacgtgatgcgggagacctacggccacctgagcgctctcggaatcggaggcaacaagccagctctcatctcctgggtggaggaggaggccgaactgtggggtccggctgcccaggatccggaggtggcgaaatgtcagacacaaacggacccagcagattccagaaacaagaaaaaggaaagacaaagggaagggacgggagccctggagaagcccgaccctgtggccgccgggtctcctgggctgaagtctccccaagccccctcggccgggcccccttatggttgggagcagctgtccaaggcaccgcaccggggacgcccctccctctgtgcccacccccctgtcccccgagctgaccagcgtcatggctgctacgtgtgcgggaagagctttgcctggcgctccacactggtggagcacgtctacagtcacactggcgagaagcccttccactgcactgactgcggcaagggcttcggccacgcttcctccctgagcaaacaccgggccatccatcgtggggagcggccccaccgctgtctggagtgtggccgggccttcacgcagcgctcggcgctgacttcgcacctgcgcgtccacaccggcgagaaaccctatggctgcgccgactgtggccgccgcttcagccagagctctgccctctaccagcaccggcgcgtgcacagcggcgagacccccttcccctgcccggactgtggccgcgccttcgcctacccctcggacctgcggcgccacgtgcgcacccacaccggcgagaagccctacccgtgcccggactgcgggcgctgcttccgccagagctcggagatggcagtccacaggcgcacccacagcggcgagaagccctacccctgcccgcagtgcggccgccgctttggccagaagtcagccgtggccaaacaccagtgggttcatcggcccggggccgggggccacaggggccgggtcgccgggcgtctgtctgtgaccctgacccctggccacggagacctggacccgcccgtgggcttccagctgtacccggagatattccaggagtgtgggtga
Sequence Length
1227
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
44,872 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 764, mRNA
NCBI Official Synonym Full Names
zinc finger protein 764
NCBI Official Symbol
ZNF764
NCBI Protein Information
zinc finger protein 764
UniProt Protein Name
Zinc finger protein 764
Protein Family
UniProt Gene Name
ZNF764
UniProt Entry Name
ZN764_HUMAN
Uniprot Description
ZNF764: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family.
Protein type: C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 16p11.2
Research Articles on ZNF764
Similar Products
Product Notes
The ZNF764 znf764 (Catalog #AAA1275113) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgccgc ctctggcccc gctccctccc cgggacccaa acggggccgg acccgagtgg agggagccgg gggctgtgag cttcgcggac gtggccgtgt acttctgccg ggaggagtgg ggctgcttgc ggccagcgca gagggccctg taccgggacg tgatgcggga gacctacggc cacctgagcg ctctcggaat cggaggcaac aagccagctc tcatctcctg ggtggaggag gaggccgaac tgtggggtcc ggctgcccag gatccggagg tggcgaaatg tcagacacaa acggacccag cagattccag aaacaagaaa aaggaaagac aaagggaagg gacgggagcc ctggagaagc ccgaccctgt ggccgccggg tctcctgggc tgaagtctcc ccaagccccc tcggccgggc ccccttatgg ttgggagcag ctgtccaagg caccgcaccg gggacgcccc tccctctgtg cccacccccc tgtcccccga gctgaccagc gtcatggctg ctacgtgtgc gggaagagct ttgcctggcg ctccacactg gtggagcacg tctacagtca cactggcgag aagcccttcc actgcactga ctgcggcaag ggcttcggcc acgcttcctc cctgagcaaa caccgggcca tccatcgtgg ggagcggccc caccgctgtc tggagtgtgg ccgggccttc acgcagcgct cggcgctgac ttcgcacctg cgcgtccaca ccggcgagaa accctatggc tgcgccgact gtggccgccg cttcagccag agctctgccc tctaccagca ccggcgcgtg cacagcggcg agaccccctt cccctgcccg gactgtggcc gcgccttcgc ctacccctcg gacctgcggc gccacgtgcg cacccacacc ggcgagaagc cctacccgtg cccggactgc gggcgctgct tccgccagag ctcggagatg gcagtccaca ggcgcaccca cagcggcgag aagccctacc cctgcccgca gtgcggccgc cgctttggcc agaagtcagc cgtggccaaa caccagtggg ttcatcggcc cggggccggg ggccacaggg gccgggtcgc cgggcgtctg tctgtgaccc tgacccctgg ccacggagac ctggacccgc ccgtgggctt ccagctgtac ccggagatat tccaggagtg tgggtga. It is sometimes possible for the material contained within the vial of "ZNF764, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
