ZNF639 cdna clone

ZNF639 cDNA Clone

Gene Names

ZNF639; ZASC1; ANC-2H01; ANC_2H01

Synonyms

ZNF639; ZNF639 cDNA Clone; ZNF639 cdna clone

Ordering
Cat. Num. AAA1278237 For Research Use Only!

Sequence

atgaatgagtatcctaaaaaaagaaaaaggaagactctacacccttctcgttattcagattcctctggaataagcagaattgcagatggattcaatggaattttctctgatcattgttacagtgtctgttctatgagacagccagatttaaaatattttgacaacaaagatgatgattctgataccgagacgtcaaatgacttgccaaaatttgcagatggaatcaaggccagaaacagaaatcagaactacctggttcccagtcctgtacttagaattctagaccacactgccttttctacagaaaaatctgctgatattgtaatttgtgatgaagagtgtgactcacctgaatcagtcaaccagcaaacccaagaggagagtcctatagaagttcacactgctgaagatgttccaattgctgtagaagtgcatgcgatttctgaggattatgatatagagacagaaaacaattcctctgagagtctccaagaccaaactgatgaagaaccgccagctaaactttgtaaaattcttgacaagagccaagctttgaatgtgactgcccagcagaaatggcctttactgagagctaatagcagtggcctctataaatgtgaactttgtgagtttaacagcaaatatttttctgacttaaagcagcatatgatcctgaagcataaacgtactgattcaaatgtgtgtcgagtatgcaaggaaagtttctctaccaatatgcttctgatagaacatgccaaactgcatgaagaggatccctacatttgtaaatactgtgattataagacagtaatttttgagaacctcagccagcacattgcagacacccattttagtgatcacctctattggtgtgaacagtgtgatgtacagttctcctcaagcagtgaactctacctacatttccaggagcacagctgtgatgaacagtacttgtgtcagttctgtgaacatgaaactaatgatccagaagacttgcatagccatgtggtaaatgagcatgcatgtaaattaatagagttaagtgataagtataacaatggtgaacatggacagtatagcctcttaagcaaaattacctttgacaaatgtaaaaacttctttgtatgtcaagtatgtggttttcggagtagacttcacacaaatgttaacaggcatgttgctattgaacatacaaaaatttttcctcatgtttgtgatgactgtgggaaaggcttttcaagtatgctagaatattgcaagcatttaaattcacatttatctgaagggatttatttatgtcaatattgtgaatattcaacaggacaaattgaagatcttaaaattcatctagatttcaagcattcagctgacttgcctcataaatgtagtgactgcttgatgaggtttggaaatgaaagggaattaataagtcaccttccagtccatgagacaacttga

Sequence Length

1458

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

18088515

NCBI GeneID

51193

Molecular Weight

56,054 Da

NCBI Official Full Name

Homo sapiens zinc finger protein 639, mRNA

NCBI Official Synonym Full Names

zinc finger protein 639

NCBI Official Symbol

ZNF639

NCBI Official Synonym Symbols

ZASC1; ANC-2H01; ANC_2H01

NCBI Protein Information

zinc finger protein 639

UniProt Protein Name

Zinc finger protein 639

Protein Family

Zinc finger protein

UniProt Gene Name

ZNF639

UniProt Synonym Gene Names

ZASC1

UniProt Entry Name

ZN639_HUMAN

NCBI Description

This gene encodes a member of the Kruppel-like zinc finger family of proteins. Amplification and overexpression of this gene have been observed in esophageal squamous cell carcinoma. The encoded protein has been shown to bind DNA in a sequence-specific manner and may regulate HIV-1 gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]

Uniprot Description

ZNF639: Binds DNA and may function as a transcriptional repressor. Belongs to the krueppel C2H2-type zinc-finger protein family.

Protein type: DNA-binding; C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 3q26.33

Cellular Component: nucleoplasm; nucleus

Molecular Function: protein binding; protein self-association; transcription factor activity

Biological Process: entry of virus into host cell; negative regulation of transcription, DNA-dependent; positive regulation of cell growth; positive regulation of transcription from RNA polymerase II promoter

Research Articles on ZNF639

1. ZASC1 as novel regulator of HIV-1 gene expression that functions through the DNA-dependent, RNA-independent recruitment of TAT/P-TEFb to the HIV-1 promoter.

Similar Products

Product Notes

The ZNF639 znf639 (Catalog #AAA1278237) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatgagt atcctaaaaa aagaaaaagg aagactctac acccttctcg ttattcagat tcctctggaa taagcagaat tgcagatgga ttcaatggaa ttttctctga tcattgttac agtgtctgtt ctatgagaca gccagattta aaatattttg acaacaaaga tgatgattct gataccgaga cgtcaaatga cttgccaaaa tttgcagatg gaatcaaggc cagaaacaga aatcagaact acctggttcc cagtcctgta cttagaattc tagaccacac tgccttttct acagaaaaat ctgctgatat tgtaatttgt gatgaagagt gtgactcacc tgaatcagtc aaccagcaaa cccaagagga gagtcctata gaagttcaca ctgctgaaga tgttccaatt gctgtagaag tgcatgcgat ttctgaggat tatgatatag agacagaaaa caattcctct gagagtctcc aagaccaaac tgatgaagaa ccgccagcta aactttgtaa aattcttgac aagagccaag ctttgaatgt gactgcccag cagaaatggc ctttactgag agctaatagc agtggcctct ataaatgtga actttgtgag tttaacagca aatatttttc tgacttaaag cagcatatga tcctgaagca taaacgtact gattcaaatg tgtgtcgagt atgcaaggaa agtttctcta ccaatatgct tctgatagaa catgccaaac tgcatgaaga ggatccctac atttgtaaat actgtgatta taagacagta atttttgaga acctcagcca gcacattgca gacacccatt ttagtgatca cctctattgg tgtgaacagt gtgatgtaca gttctcctca agcagtgaac tctacctaca tttccaggag cacagctgtg atgaacagta cttgtgtcag ttctgtgaac atgaaactaa tgatccagaa gacttgcata gccatgtggt aaatgagcat gcatgtaaat taatagagtt aagtgataag tataacaatg gtgaacatgg acagtatagc ctcttaagca aaattacctt tgacaaatgt aaaaacttct ttgtatgtca agtatgtggt tttcggagta gacttcacac aaatgttaac aggcatgttg ctattgaaca tacaaaaatt tttcctcatg tttgtgatga ctgtgggaaa ggcttttcaa gtatgctaga atattgcaag catttaaatt cacatttatc tgaagggatt tatttatgtc aatattgtga atattcaaca ggacaaattg aagatcttaa aattcatcta gatttcaagc attcagctga cttgcctcat aaatgtagtg actgcttgat gaggtttgga aatgaaaggg aattaataag tcaccttcca gtccatgaga caacttga. It is sometimes possible for the material contained within the vial of "ZNF639, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

ZNF639 cdna clone