ZNF622 cdna clone
ZNF622 cDNA Clone
Gene Names
ZNF622; ZPR9
Synonyms
ZNF622; ZNF622 cDNA Clone; ZNF622 cdna clone
Sequence
atggcgacgtacacctgcataacttgccgggtggcgttccgcgacgcggacatgcagcgggcccactataagacggactggcaccgctacaacctgcggcggaaggtggccagcatggccccagtgaccgccgagggcttccaggagcgagtgcgggcgcagcgggccgtcgcggaggaggagagcaagggctcggccacctactgcaccgtttgcagtaagaagtttgcctctttcaacgcctacgagaaccacctcaagtcccggcgtcacgttgagctggagaagaaggccgtgcaggcagtgaatcggaaagtggagatgatgaatgaaaagaacttggagaaaggactgggcgtggacagtgtggacaaggatgccatgaacgcggccatccagcaggccatcaaggcccagccgtccatgtctcccaagaaggcgcccccagcgcctgcaaaggaggccaggaatgtcgtggccgtgggtactggtggccgtgggacccacgaccgagacccgagtgagaaaccaccccggctccagtggtttgaacagcaggcgaagaagttggcaaagcagcaggaggaggacagcgaggaggaggaagaggacctggatggagacgattgggaagatattgattctgatgaagaattggaatgtgaggatactgaagcaatggacgatgtggtggagcaggatgcagaggaggaagaggctgaggaaggcccaccccttggtgccatccctatcacggactgcttattttgttcccatcattccagctcgctgatgaagaatgtggctcacatgaccaaagaccacagtttctttattcctgatatagaatatctttcagatattaagggactgattaaatacttgggagagaaagttggtgttggcaagatttgcttgtggtgcaacgagaaagggaagtccttctactccacagaagctgtacaggcacatatgaatgacaaaagccactgtaagctcttcacagatggcgatgctgctttggaatttgcagacttctatgattttaggagtagctatccagatcacaaggaaggggaggaccccaataaggctgaggagttgccctcagaaaagaacttggaatatgatgatgaaaccatggaattgattctgccttctggtgccagagtgggtcatcgctccttgatgagatactacaaacagcgatttggcttgtcaagagctgtggcagttgccaaaaatcggaaggccgtgggccgagtacttcagcagtacagagccctgggatggactggcagcacaggagcggctcttatgcgagagcgagacatgcagtatgtccaaaggatgaaatcaaaatggatgctgaagacaggaatgaagaacaatgccaccaagcagatgcactttcgggtccaagtgagattctga
Sequence Length
1434
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
54,272 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 622, mRNA
NCBI Official Synonym Full Names
zinc finger protein 622
NCBI Official Symbol
ZNF622
NCBI Official Synonym Symbols
ZPR9
NCBI Protein Information
zinc finger protein 622
UniProt Protein Name
Zinc finger protein 622
Protein Family
UniProt Gene Name
ZNF622
UniProt Synonym Gene Names
ZPR9
UniProt Entry Name
ZN622_HUMAN
Uniprot Description
ZNF622: May behave as an activator of the bound transcription factor, MYBL2, and be involved in embryonic development.
Protein type: Transcription factor
Chromosomal Location of Human Ortholog: 5p15.1
Cellular Component: cytoplasm; Golgi apparatus; nucleolus
Molecular Function: protein binding
Biological Process: induction of apoptosis by oxidative stress; positive regulation of apoptosis; positive regulation of JNK cascade; positive regulation of kinase activity; positive regulation of MAPKKK cascade; ribosomal large subunit biogenesis and assembly
Research Articles on ZNF622
Similar Products
Product Notes
The ZNF622 znf622 (Catalog #AAA1266941) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgacgt acacctgcat aacttgccgg gtggcgttcc gcgacgcgga catgcagcgg gcccactata agacggactg gcaccgctac aacctgcggc ggaaggtggc cagcatggcc ccagtgaccg ccgagggctt ccaggagcga gtgcgggcgc agcgggccgt cgcggaggag gagagcaagg gctcggccac ctactgcacc gtttgcagta agaagtttgc ctctttcaac gcctacgaga accacctcaa gtcccggcgt cacgttgagc tggagaagaa ggccgtgcag gcagtgaatc ggaaagtgga gatgatgaat gaaaagaact tggagaaagg actgggcgtg gacagtgtgg acaaggatgc catgaacgcg gccatccagc aggccatcaa ggcccagccg tccatgtctc ccaagaaggc gcccccagcg cctgcaaagg aggccaggaa tgtcgtggcc gtgggtactg gtggccgtgg gacccacgac cgagacccga gtgagaaacc accccggctc cagtggtttg aacagcaggc gaagaagttg gcaaagcagc aggaggagga cagcgaggag gaggaagagg acctggatgg agacgattgg gaagatattg attctgatga agaattggaa tgtgaggata ctgaagcaat ggacgatgtg gtggagcagg atgcagagga ggaagaggct gaggaaggcc caccccttgg tgccatccct atcacggact gcttattttg ttcccatcat tccagctcgc tgatgaagaa tgtggctcac atgaccaaag accacagttt ctttattcct gatatagaat atctttcaga tattaaggga ctgattaaat acttgggaga gaaagttggt gttggcaaga tttgcttgtg gtgcaacgag aaagggaagt ccttctactc cacagaagct gtacaggcac atatgaatga caaaagccac tgtaagctct tcacagatgg cgatgctgct ttggaatttg cagacttcta tgattttagg agtagctatc cagatcacaa ggaaggggag gaccccaata aggctgagga gttgccctca gaaaagaact tggaatatga tgatgaaacc atggaattga ttctgccttc tggtgccaga gtgggtcatc gctccttgat gagatactac aaacagcgat ttggcttgtc aagagctgtg gcagttgcca aaaatcggaa ggccgtgggc cgagtacttc agcagtacag agccctggga tggactggca gcacaggagc ggctcttatg cgagagcgag acatgcagta tgtccaaagg atgaaatcaa aatggatgct gaagacagga atgaagaaca atgccaccaa gcagatgcac tttcgggtcc aagtgagatt ctga. It is sometimes possible for the material contained within the vial of "ZNF622, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
