ZNF619 cdna clone
ZNF619 cDNA Clone
Synonyms
ZNF619; ZNF619 cDNA Clone; ZNF619 cdna clone
Sequence
atgggccagcctgcaccctacgcagagggccctatacagggaggtgatgctggagaattatgcaaatgtgacttccttgtcagcatttccattccccaaaccagatctgatattccagctggagcaaggagaagcagcatggggcccagatccctggacacttgctgggggagaggccctgagaggcatgtgcacagagtttcacttttgttgcccaggctggagtgcaatggcgtgatcttcactcaccgcaacctctgccttccaggtggtaaaaccaagactgagaatgaggaaaaaactgcacagctaaacatttctaaagaatcagagtcccacagactgatagtggagggactgctgatggacgttccccagcaccctgacttcaaggacaggttagagaagtcacagctacatgatacagggaataaaacaaagataggggattgcacagatttgacagtccaggatcatgaatcttccaccactgaaagggaggagatagccaggaaattggaagaaagtagtgtcagcacacatctcattacaaagcagggttttgccaaagaacaggtgttttataaatgtggtgagtgtggcagttactacaacccacattcagactttcacctgcatcagagagttcacactaatgagaagccctacacatgcaaagaatgtgggaaaaccttcagatataactcaaaactgtcacggcatcagaaaatccacactggagagaaaccatactcatgtgaggaatgtggacaagccttcagtcaaaattcccaccttcttcagcatcagaagctccatggtggacagaggccctatgaatgtactgactgtggtaaaaccttcagttataattcaaaactgattcggcatcagagaatccatactggggagaagccctttaaatgtaaggaatgtgggaaagccttcagttgtagctatgactgcatcatccatgaacgaattcacaatggggagaagccctatgaatgtaaggagtgtgggaagagtttgagttctaattcagttctgattcagcatcagagaatccacactggggagaaaccttatgaatgtaaagagtgtggcaaggccttccaccgcagttcggtatttcttcagcaccagaggttccacactggggaacaactctacaaatgtaatgaatgttggaaaactttcagctgtagctcccgcttcatagtgcatcagagaatccacaatggggagaaaccctatgaatgccaggaatgtgggaagacattcagtcaaaagatcactctggttcagcatcagcgagttcacactggggagaaaccttatgagtgtaaggagtgcgggaaagccttcagatggaatgcaagtttcatccagcatcagaagtggcatactaggaagaaactcatcaatggaacagggctatccgcagttaagccctactgtccctgcgccatcctctctcctctgcctccccaacatacctgctctgccctagccccaccagggcctcccttatcttcttcacatgcagtggtacttcctccctctgtgcctttcttcctgctgcttccctcatctgaaaaggccaacccttcacctgtccaaatagcacatttttttcaggatctcgcttttcctgggaagtcatcccttcagagcccgaatcctttgtctcactccctgtaa
Sequence Length
1704
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
69,776 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 619, mRNA
NCBI Official Synonym Full Names
zinc finger protein 619
NCBI Official Symbol
ZNF619
NCBI Protein Information
zinc finger protein 619
UniProt Protein Name
Zinc finger protein 619
Protein Family
UniProt Gene Name
ZNF619
UniProt Entry Name
ZN619_HUMAN
Uniprot Description
ZNF619: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 3p22.1
Similar Products
Product Notes
The ZNF619 znf619 (Catalog #AAA1272881) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggccagc ctgcacccta cgcagagggc cctatacagg gaggtgatgc tggagaatta tgcaaatgtg acttccttgt cagcatttcc attccccaaa ccagatctga tattccagct ggagcaagga gaagcagcat ggggcccaga tccctggaca cttgctgggg gagaggccct gagaggcatg tgcacagagt ttcacttttg ttgcccaggc tggagtgcaa tggcgtgatc ttcactcacc gcaacctctg ccttccaggt ggtaaaacca agactgagaa tgaggaaaaa actgcacagc taaacatttc taaagaatca gagtcccaca gactgatagt ggagggactg ctgatggacg ttccccagca ccctgacttc aaggacaggt tagagaagtc acagctacat gatacaggga ataaaacaaa gataggggat tgcacagatt tgacagtcca ggatcatgaa tcttccacca ctgaaaggga ggagatagcc aggaaattgg aagaaagtag tgtcagcaca catctcatta caaagcaggg ttttgccaaa gaacaggtgt tttataaatg tggtgagtgt ggcagttact acaacccaca ttcagacttt cacctgcatc agagagttca cactaatgag aagccctaca catgcaaaga atgtgggaaa accttcagat ataactcaaa actgtcacgg catcagaaaa tccacactgg agagaaacca tactcatgtg aggaatgtgg acaagccttc agtcaaaatt cccaccttct tcagcatcag aagctccatg gtggacagag gccctatgaa tgtactgact gtggtaaaac cttcagttat aattcaaaac tgattcggca tcagagaatc catactgggg agaagccctt taaatgtaag gaatgtggga aagccttcag ttgtagctat gactgcatca tccatgaacg aattcacaat ggggagaagc cctatgaatg taaggagtgt gggaagagtt tgagttctaa ttcagttctg attcagcatc agagaatcca cactggggag aaaccttatg aatgtaaaga gtgtggcaag gccttccacc gcagttcggt atttcttcag caccagaggt tccacactgg ggaacaactc tacaaatgta atgaatgttg gaaaactttc agctgtagct cccgcttcat agtgcatcag agaatccaca atggggagaa accctatgaa tgccaggaat gtgggaagac attcagtcaa aagatcactc tggttcagca tcagcgagtt cacactgggg agaaacctta tgagtgtaag gagtgcggga aagccttcag atggaatgca agtttcatcc agcatcagaa gtggcatact aggaagaaac tcatcaatgg aacagggcta tccgcagtta agccctactg tccctgcgcc atcctctctc ctctgcctcc ccaacatacc tgctctgccc tagccccacc agggcctccc ttatcttctt cacatgcagt ggtacttcct ccctctgtgc ctttcttcct gctgcttccc tcatctgaaa aggccaaccc ttcacctgtc caaatagcac atttttttca ggatctcgct tttcctggga agtcatccct tcagagcccg aatcctttgt ctcactccct gtaa. It is sometimes possible for the material contained within the vial of "ZNF619, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
