Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF593 cdna clone

ZNF593 cDNA Clone

Gene Names
ZNF593; ZT86
Synonyms
ZNF593; ZNF593 cDNA Clone; ZNF593 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaggcgaagcggcggcggccggacttggatgagattcaccgcgagctgcggcctcagggatccgcacgaccccagcccgacccaaacgccgagttcgaccccgacctgccagggggcggtctgcaccgctgtctggcctgcgcgaggtacttcatcgattccaccaacctgaagacccacttccgatccaaagaccacaagaaaaggctgaagcagctgagcgtcgagccctacagtcaggaagaggcggagagggcagcgggtatgggatcctatgtgccccccaggcggctggcagtgcccacggaagtgtccactgaggtccctgagatggatacctctacctga
Sequence Length
351
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,199 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 593, mRNA
NCBI Official Synonym Full Names
zinc finger protein 593
NCBI Official Symbol
ZNF593
NCBI Official Synonym Symbols
ZT86
NCBI Protein Information
zinc finger protein 593
UniProt Protein Name
Zinc finger protein 593
Protein Family
UniProt Gene Name
ZNF593
UniProt Synonym Gene Names
ZT86
UniProt Entry Name
ZN593_HUMAN

Uniprot Description

ZNF593: Negatively modulates the DNA binding activity of Oct-2 and therefore its transcriptional regulatory activity. Could act either by binding to DNA octamer or by interacting with Oct-2. May also be a modulator of other octamer-binding proteins. Belongs to the ZNF593/BUD20 C2H2-type zinc-finger protein family.

Protein type: C2H2-type zinc finger protein; Nucleolus

Chromosomal Location of Human Ortholog: 1p36.11

Cellular Component: nucleolus; nucleus

Molecular Function: protein binding; transcription corepressor activity

Biological Process: negative regulation of transcription from RNA polymerase II promoter

Research Articles on ZNF593

Similar Products

Product Notes

The ZNF593 znf593 (Catalog #AAA1278948) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggcga agcggcggcg gccggacttg gatgagattc accgcgagct gcggcctcag ggatccgcac gaccccagcc cgacccaaac gccgagttcg accccgacct gccagggggc ggtctgcacc gctgtctggc ctgcgcgagg tacttcatcg attccaccaa cctgaagacc cacttccgat ccaaagacca caagaaaagg ctgaagcagc tgagcgtcga gccctacagt caggaagagg cggagagggc agcgggtatg ggatcctatg tgccccccag gcggctggca gtgcccacgg aagtgtccac tgaggtccct gagatggata cctctacctg a. It is sometimes possible for the material contained within the vial of "ZNF593, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.