Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF530 cdna clone

ZNF530 cDNA Clone

Synonyms
ZNF530; ZNF530 cDNA Clone; ZNF530 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcggcactgagggccccgacccagcaggtttttgtagcctttgaggatgtggccatttacttctcccaggaggagtgggagctccttgatgagatgcagaggctcctgtaccgcgatgtgatgctggagaactttgcagttatggcatccctaggttgctggtgtggagcagtagatgaggggacgccttctgcagagagcgtttctgtggaagaactgtcacagggcaggactccaaaggcagatacatccactgataagagtcacccctgtgagatttgtaccccagtcctgagagacattttacaaatgattgagctccaagcctcaccctgtggacagaaattgtacttgggtggagcaccaagagatttctggatgagttcaaaccttcaccagctccagaagcttgataatggagagaagctctttaaagtggatggggaccaggcctcatttatgatgaactgcaggttccatgtgtcaggaaaacccttcacgtttggggaagtcgggagggacttttcagccacctcaggacttctccagcatcaggtgactcccaccattgagagaccacacagcaggattagacacttgagagttcccactggacgaaagcctctcaaatacactgaatccaggaaatcttttagagagaaatctgtattcattcaacaccaaagagctgactctggagaaaggccttacaagtgcagtgaatgtgggaaatcctttagtcaaagttctggctttcttcgacacaggaaagcacacggtagaacaaggactcatgaatgtagtgaatgtgggaaatcatttagtcgcaaaactcacctaactcaacaccaaagagttcacactggagaaaggccttatgactgcagtgaatgtggcaaatcctttcgccaggtatctgtcctcattcaacatcaacgagttcacactggagaaaggccttatgagtgcagtgaatgtgggaaatcttttagccacagcactaacctctatcgtcacaggagtgcccacactagcacaaggccttatgagtgcagtgaatgtggaaaatcctttagccatagcactaacctctttcgacactggagagttcacactggagtaaggccttatgagtgtagtgaatgtgggaaagcatttagttgcaatatctaccttattcaccaccaaagatttcacactggagaaagaccttatgtgtgcagtgaatgtgggaaatcatttggccagaaatctgtcctcattcaacaccaaagagttcacactggagaaaggccttatgagtgcagtgaatgtgggaaagtttttagccaaagctctggcctctttcgacacagaagagctcacactaaaacaaagccttatgagtgcagtgaatgtgaaaaatcatttagttgcaaaactgacctcattcgacaccagacagttcacactggagaaaggccttatgagtgcagtgtatgtgggaaatcttttatccgaaaaacccacctcattcgacaccagactgttcacactaatgaaaggccttatgagtgcgatgaatgtgggaaatcctatagccaaagctctgccctccttcagcataggagagttcacactggagaaaggccttatgagtgcagagaatgtgggaaatcttttacccgcaaaaatcacctcattcaacacaagacagttcacactggagaaaggccttatgaatgcagtgaatgtggaaaatcctttagccaaagctctggcctcttaagacacagaagagttcatgtgcagtga
Sequence Length
1800
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
68,837 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 530, mRNA
NCBI Official Synonym Full Names
zinc finger protein 530
NCBI Official Symbol
ZNF530
NCBI Protein Information
zinc finger protein 530
UniProt Protein Name
Zinc finger protein 530
Protein Family
UniProt Gene Name
ZNF530
UniProt Synonym Gene Names
KIAA1508
UniProt Entry Name
ZN530_HUMAN

Uniprot Description

ZNF530: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family.

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 19q13.43

Similar Products

Product Notes

The ZNF530 znf530 (Catalog #AAA1278464) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg cactgagggc cccgacccag caggtttttg tagcctttga ggatgtggcc atttacttct cccaggagga gtgggagctc cttgatgaga tgcagaggct cctgtaccgc gatgtgatgc tggagaactt tgcagttatg gcatccctag gttgctggtg tggagcagta gatgagggga cgccttctgc agagagcgtt tctgtggaag aactgtcaca gggcaggact ccaaaggcag atacatccac tgataagagt cacccctgtg agatttgtac cccagtcctg agagacattt tacaaatgat tgagctccaa gcctcaccct gtggacagaa attgtacttg ggtggagcac caagagattt ctggatgagt tcaaaccttc accagctcca gaagcttgat aatggagaga agctctttaa agtggatggg gaccaggcct catttatgat gaactgcagg ttccatgtgt caggaaaacc cttcacgttt ggggaagtcg ggagggactt ttcagccacc tcaggacttc tccagcatca ggtgactccc accattgaga gaccacacag caggattaga cacttgagag ttcccactgg acgaaagcct ctcaaataca ctgaatccag gaaatctttt agagagaaat ctgtattcat tcaacaccaa agagctgact ctggagaaag gccttacaag tgcagtgaat gtgggaaatc ctttagtcaa agttctggct ttcttcgaca caggaaagca cacggtagaa caaggactca tgaatgtagt gaatgtggga aatcatttag tcgcaaaact cacctaactc aacaccaaag agttcacact ggagaaaggc cttatgactg cagtgaatgt ggcaaatcct ttcgccaggt atctgtcctc attcaacatc aacgagttca cactggagaa aggccttatg agtgcagtga atgtgggaaa tcttttagcc acagcactaa cctctatcgt cacaggagtg cccacactag cacaaggcct tatgagtgca gtgaatgtgg aaaatccttt agccatagca ctaacctctt tcgacactgg agagttcaca ctggagtaag gccttatgag tgtagtgaat gtgggaaagc atttagttgc aatatctacc ttattcacca ccaaagattt cacactggag aaagacctta tgtgtgcagt gaatgtggga aatcatttgg ccagaaatct gtcctcattc aacaccaaag agttcacact ggagaaaggc cttatgagtg cagtgaatgt gggaaagttt ttagccaaag ctctggcctc tttcgacaca gaagagctca cactaaaaca aagccttatg agtgcagtga atgtgaaaaa tcatttagtt gcaaaactga cctcattcga caccagacag ttcacactgg agaaaggcct tatgagtgca gtgtatgtgg gaaatctttt atccgaaaaa cccacctcat tcgacaccag actgttcaca ctaatgaaag gccttatgag tgcgatgaat gtgggaaatc ctatagccaa agctctgccc tccttcagca taggagagtt cacactggag aaaggcctta tgagtgcaga gaatgtggga aatcttttac ccgcaaaaat cacctcattc aacacaagac agttcacact ggagaaaggc cttatgaatg cagtgaatgt ggaaaatcct ttagccaaag ctctggcctc ttaagacaca gaagagttca tgtgcagtga. It is sometimes possible for the material contained within the vial of "ZNF530, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.