ZNF502 cdna clone
ZNF502 cDNA Clone
Synonyms
ZNF502; ZNF502 cDNA Clone; ZNF502 cdna clone
Sequence
atgttgaatatgcaaggagctgaagagagagacattagaagagagacttgtccaggctgggtaaacaagaacaagcctgctctggagcaggatgtctgtaaaattgactcatcagggatagtagtaaagaggttccaagaggatgaataccaagattctacatttgaagaaaaatatgcatgtgagggcatgaaggaaaactctcctagggagattgctgaatcatgccttttccaggaaggaggttttgggagaataactttcatccacaaagaagcaccccctgaaattattagtcaaggatataattttgagaaaagcttgcttttgacctcaagccttgttacacgtctcagggtttctacagaagagagtctgcatcagtgggaaacaagtaatatacaaaccaatgatatttcagaccaaagtaaatgtccaactctctgcacacagaaaaaatcttggaaatgtaatgaatgtggaaaaacctttactcagagctcatcccttacccaacatcagagaactcatactggagagagaccctacacatgtgaggaatgtgggaaagcctttagtcgtagttcattccttgttcaacatcaaagaattcacactggagtgaaaccatatggatgtgagcagtgtgggaaaacatttcgatgtcgatcatttcttactcagcatcaaagaattcacactggagagaaaccttataaatgcaatgaatgtgggaattccttccgcaatcactcacatctcactgaacaccagagaattcacactggagagaaaccttataaatgcaataggtgtgggaaggcattcaatcagaatacacaccttattcatcatcagagaattcacactggtgagaagccttacatatgcagtgaatgtggctcttcttttcgaaaacactcaaatcttacgcaacatcagagaattcacactggggaaaaaccccataaatgtgacgaatgtgggaaaactttccaaacaaaggcaaacctctctcagcatcagagaattcatagtggagagaaaccctataaatgtaaagaatgtggcaaagccttttgtcagagcccatctcttattaaacaccagcgaattcatactggagaaaaaccatataagtgtaaagaatgtggcaaagcgtttactcagagcaccccactcactaaacatcagagaatacatacaggggagagaccctacaaatgcagtgaatgtggtaaagccttcattcagagcatttgccttattcggcaccagagaagtcacactggagaaaaaccctataaatgcaatgaatgtggaaagggctttaatcagaacacctgcctcactcagcatatgagaattcatactggagagaagccctataaatgtaaagaatgtgggaaagcctttgctcatagctcatctcttactgaacatcatagaactcacactggtgagaagctctataaatgtagtgagtgtgagaaaaccttccgcaagtatgcacaccttagtgaacattacagaattcacactggtgagaagccttatgagtgtattgagtgtggaaagttcttcagacatagttcagtccttttcagacatcagaaacttcacagtggtgactaa
Sequence Length
1635
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
62,920 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 502, mRNA
NCBI Official Synonym Full Names
zinc finger protein 502
NCBI Official Symbol
ZNF502
NCBI Protein Information
zinc finger protein 502
UniProt Protein Name
Zinc finger protein 502
Protein Family
UniProt Gene Name
ZNF502
UniProt Entry Name
ZN502_HUMAN
Uniprot Description
ZNF502: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family.
Protein type: C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 3p21.31
Cellular Component: nucleus
Molecular Function: protein binding
Biological Process: regulation of transcription, DNA-dependent
Research Articles on ZNF502
Similar Products
Product Notes
The ZNF502 znf502 (Catalog #AAA1271854) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttgaata tgcaaggagc tgaagagaga gacattagaa gagagacttg tccaggctgg gtaaacaaga acaagcctgc tctggagcag gatgtctgta aaattgactc atcagggata gtagtaaaga ggttccaaga ggatgaatac caagattcta catttgaaga aaaatatgca tgtgagggca tgaaggaaaa ctctcctagg gagattgctg aatcatgcct tttccaggaa ggaggttttg ggagaataac tttcatccac aaagaagcac cccctgaaat tattagtcaa ggatataatt ttgagaaaag cttgcttttg acctcaagcc ttgttacacg tctcagggtt tctacagaag agagtctgca tcagtgggaa acaagtaata tacaaaccaa tgatatttca gaccaaagta aatgtccaac tctctgcaca cagaaaaaat cttggaaatg taatgaatgt ggaaaaacct ttactcagag ctcatccctt acccaacatc agagaactca tactggagag agaccctaca catgtgagga atgtgggaaa gcctttagtc gtagttcatt ccttgttcaa catcaaagaa ttcacactgg agtgaaacca tatggatgtg agcagtgtgg gaaaacattt cgatgtcgat catttcttac tcagcatcaa agaattcaca ctggagagaa accttataaa tgcaatgaat gtgggaattc cttccgcaat cactcacatc tcactgaaca ccagagaatt cacactggag agaaacctta taaatgcaat aggtgtggga aggcattcaa tcagaataca caccttattc atcatcagag aattcacact ggtgagaagc cttacatatg cagtgaatgt ggctcttctt ttcgaaaaca ctcaaatctt acgcaacatc agagaattca cactggggaa aaaccccata aatgtgacga atgtgggaaa actttccaaa caaaggcaaa cctctctcag catcagagaa ttcatagtgg agagaaaccc tataaatgta aagaatgtgg caaagccttt tgtcagagcc catctcttat taaacaccag cgaattcata ctggagaaaa accatataag tgtaaagaat gtggcaaagc gtttactcag agcaccccac tcactaaaca tcagagaata catacagggg agagacccta caaatgcagt gaatgtggta aagccttcat tcagagcatt tgccttattc ggcaccagag aagtcacact ggagaaaaac cctataaatg caatgaatgt ggaaagggct ttaatcagaa cacctgcctc actcagcata tgagaattca tactggagag aagccctata aatgtaaaga atgtgggaaa gcctttgctc atagctcatc tcttactgaa catcatagaa ctcacactgg tgagaagctc tataaatgta gtgagtgtga gaaaaccttc cgcaagtatg cacaccttag tgaacattac agaattcaca ctggtgagaa gccttatgag tgtattgagt gtggaaagtt cttcagacat agttcagtcc ttttcagaca tcagaaactt cacagtggtg actaa. It is sometimes possible for the material contained within the vial of "ZNF502, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
