ZNF449 cdna clone
ZNF449 cDNA Clone
Gene Names
ZNF449; ZSCAN19
Synonyms
ZNF449; ZNF449 cDNA Clone; ZNF449 cdna clone
Sequence
atggctgtggccctgggttgtgcaatccaggcatccttgaatcaaggctctgtgtttcaagaatatgatactgactgtgaagttttccgtcagcgcttcaggcagttccagtacagagaagcagctgggcctcatgaagcatttaacaaactctgggagctttgctgtcaatggctgaagccaaagatgcgctctaaggaacaaatcctggagctgctagtgttggagcaattcctaactatcctgcccacagagatagagacctgggtgagggagcactgcccagagaatagagaaagagttgtgtcactgatagaagacttacagagagaacttgagataccagagcagcaggttgatatgcatgacatgctcttggaagaactggcaccagtgggaacggcacacataccaccaaccatgcacctagagtcacctgcactccaggtaatgggacctgcccaggaggccccagtagcagaggcatggatcccacaggcagggccaccggagctgaactatggtgctactggagaatgtcagaactttctggaccctggatatccattaccaaaacttgacatgaacttctcattggagaatagagaagagccatgggtgaaggaattacaggattctaaagaaatgaaacaattacttgattccaagataggttttgagatcgggatagaaaatgaagaagatacttcaaaacagaaaaaaatggagactatgtatccatttattgtaactttagaggggaatgctctccagggtcccattttgcaaaaagactatgtacagttagaaaatcaatgggaaacccccccagaggatttacagacagatttagcaaaactggtagatcagcagaaccccactctgggagagacacctgagaactccaacttggaagaacctctcaaccctaaaccccacaagaaaaagagtccaggagagaaacctcaccgatgtcctcagtgtggaaaatgttttgctcggaagtcacaacttactgggcatcagagaattcattcaggagaagaacctcacaaatgccctgaatgtgggaaaagattccttcgtagttcagacctttatagacaccaacgacttcatacaggggagagaccctatgaatgcactgtatgtaaaaagcgattcactcggcggtcacatcttatagggcaccagagaacccattctgaagaagaaacatataaatgtcttgagtgtgggaaaagtttttgtcatggatcaagtcttaaaagacatctgaaaactcatacaggtgaaaaacctcatagatgtcataattgtgggaaaagttttagtcgactgacagctcttactttgcaccagagaacgcatactgaagagagaccttttaaatgtaattattgtgggaaaagttttagacagagaccaagcctcgttattcatttaagaatccacacaggggagaagccatacaagtgtactcattgttctaaaagcttcagacagagagccggccttattatgcaccaggtcactcactttagaggacttatttaa
Sequence Length
1557
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
15,111 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 449, mRNA
NCBI Official Synonym Full Names
zinc finger protein 449
NCBI Official Symbol
ZNF449
NCBI Official Synonym Symbols
ZSCAN19
NCBI Protein Information
zinc finger protein 449
UniProt Protein Name
Zinc finger protein 449
Protein Family
UniProt Gene Name
ZNF449
UniProt Synonym Gene Names
ZSCAN19
UniProt Entry Name
ZN449_HUMAN
NCBI Description
This gene encodes a nuclear protein that likely functions as a transcription factor. The protein includes an N-terminal SCAN domain, and seven C2H2-type zinc finger motifs. [provided by RefSeq, May 2010]
Uniprot Description
ZNF449: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: C2H2-type zinc finger protein; DNA-binding; Transcription factor
Chromosomal Location of Human Ortholog: Xq26.3
Cellular Component: nucleus
Molecular Function: protein binding; sequence-specific DNA binding; transcription factor activity
Research Articles on ZNF449
Similar Products
Product Notes
The ZNF449 znf449 (Catalog #AAA1273386) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgtgg ccctgggttg tgcaatccag gcatccttga atcaaggctc tgtgtttcaa gaatatgata ctgactgtga agttttccgt cagcgcttca ggcagttcca gtacagagaa gcagctgggc ctcatgaagc atttaacaaa ctctgggagc tttgctgtca atggctgaag ccaaagatgc gctctaagga acaaatcctg gagctgctag tgttggagca attcctaact atcctgccca cagagataga gacctgggtg agggagcact gcccagagaa tagagaaaga gttgtgtcac tgatagaaga cttacagaga gaacttgaga taccagagca gcaggttgat atgcatgaca tgctcttgga agaactggca ccagtgggaa cggcacacat accaccaacc atgcacctag agtcacctgc actccaggta atgggacctg cccaggaggc cccagtagca gaggcatgga tcccacaggc agggccaccg gagctgaact atggtgctac tggagaatgt cagaactttc tggaccctgg atatccatta ccaaaacttg acatgaactt ctcattggag aatagagaag agccatgggt gaaggaatta caggattcta aagaaatgaa acaattactt gattccaaga taggttttga gatcgggata gaaaatgaag aagatacttc aaaacagaaa aaaatggaga ctatgtatcc atttattgta actttagagg ggaatgctct ccagggtccc attttgcaaa aagactatgt acagttagaa aatcaatggg aaaccccccc agaggattta cagacagatt tagcaaaact ggtagatcag cagaacccca ctctgggaga gacacctgag aactccaact tggaagaacc tctcaaccct aaaccccaca agaaaaagag tccaggagag aaacctcacc gatgtcctca gtgtggaaaa tgttttgctc ggaagtcaca acttactggg catcagagaa ttcattcagg agaagaacct cacaaatgcc ctgaatgtgg gaaaagattc cttcgtagtt cagaccttta tagacaccaa cgacttcata caggggagag accctatgaa tgcactgtat gtaaaaagcg attcactcgg cggtcacatc ttatagggca ccagagaacc cattctgaag aagaaacata taaatgtctt gagtgtggga aaagtttttg tcatggatca agtcttaaaa gacatctgaa aactcataca ggtgaaaaac ctcatagatg tcataattgt gggaaaagtt ttagtcgact gacagctctt actttgcacc agagaacgca tactgaagag agacctttta aatgtaatta ttgtgggaaa agttttagac agagaccaag cctcgttatt catttaagaa tccacacagg ggagaagcca tacaagtgta ctcattgttc taaaagcttc agacagagag ccggccttat tatgcaccag gtcactcact ttagaggact tatttaa. It is sometimes possible for the material contained within the vial of "ZNF449, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
