ZNF446 cdna clone
ZNF446 cDNA Clone
Gene Names
ZNF446; ZSCAN30; ZSCAN52; ZKSCAN20
Synonyms
ZNF446; ZNF446 cDNA Clone; ZNF446 cdna clone
Sequence
atgccatcccctctgggtcccccatgcctgcccgtcatggacccagagaccacccttgaggagcctgagactgcccgcctccgcttccgagggttctgctaccaggaggtggcaggtccccgagaagccctggcccggctgcgtgagctgtgttgccagtggctgcagcctgaggcacactccaaggagcagatgctggagatgctggtgctggagcagttcctgggcacactgcctcccgagatccaggcctgggtgcgcggtcagcggccaggcagtcctgaggaggccgctgccctagtcgaaggactgcagcatgaccctgggcaactgttgggctggatcacagcccatgtcctgaagcaggaggtgctccctgcagcccagaagacagaggaaccacttgggagcccccacccctcagggacagtggagtcccctggggaaggtccccaggacaccagaatagaggggtctgtccagctcagctgcagtgtgaaggaggagcccaatgtcgatggacaggaagtggcaccctccagccctccacttgcagcacagtcccctgaggggcaccatggacaccaagaaccagcctccacatccttccacccacccaggattcaggaggagtgggggctgctggaccggtcacagaaggaactgtactgggatgcgatgctggagaagtacggcacagtggtctccctggggttaccgccccaccagccagaggcacaggcccagtcagagctggggatgctgctcacggggacaggcgtctgcagaagcctgcgctcgggaaatgagagtgagggtccacctggctgcccagaggcccagccgccccagggcccagggccggcagcctgggagggcttgtctggggctgccactcctgcccccactgtgcgcccagggacaccgccagtgcccactcagcccacacctgcagagacgagactggagccggctgccacccccaggaagccctacacgtgcgagcagtgtggccgcggcttcgactggaagtcagtgttcgtcatccaccaccggacacacacgagtgggccaggtgtgcagtccccggggctagccaccggggaaagcacagagaagccaccacaaggggaggtggcctttccgcaccacccccgacactcactcacaggcccccggagttacccgtgtgaggagtgcgggtgcagcttcagctggaagtcgcagctggtcatccaccgcaagagccaccggccggaggttccatga
Sequence Length
1269
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
48,957 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 446, mRNA
NCBI Official Synonym Full Names
zinc finger protein 446
NCBI Official Symbol
ZNF446
NCBI Official Synonym Symbols
ZSCAN30; ZSCAN52; ZKSCAN20
NCBI Protein Information
zinc finger protein 446
UniProt Protein Name
Zinc finger protein 446
Protein Family
UniProt Gene Name
ZNF446
UniProt Synonym Gene Names
ZKSCAN20
UniProt Entry Name
ZN446_HUMAN
Uniprot Description
ZNF446: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family.
Protein type: C2H2-type zinc finger protein; DNA-binding; Transcription factor
Chromosomal Location of Human Ortholog: 19q13.43
Cellular Component: extracellular space; nucleus
Research Articles on ZNF446
Similar Products
Product Notes
The ZNF446 znf446 (Catalog #AAA1274231) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccatccc ctctgggtcc cccatgcctg cccgtcatgg acccagagac cacccttgag gagcctgaga ctgcccgcct ccgcttccga gggttctgct accaggaggt ggcaggtccc cgagaagccc tggcccggct gcgtgagctg tgttgccagt ggctgcagcc tgaggcacac tccaaggagc agatgctgga gatgctggtg ctggagcagt tcctgggcac actgcctccc gagatccagg cctgggtgcg cggtcagcgg ccaggcagtc ctgaggaggc cgctgcccta gtcgaaggac tgcagcatga ccctgggcaa ctgttgggct ggatcacagc ccatgtcctg aagcaggagg tgctccctgc agcccagaag acagaggaac cacttgggag cccccacccc tcagggacag tggagtcccc tggggaaggt ccccaggaca ccagaataga ggggtctgtc cagctcagct gcagtgtgaa ggaggagccc aatgtcgatg gacaggaagt ggcaccctcc agccctccac ttgcagcaca gtcccctgag gggcaccatg gacaccaaga accagcctcc acatccttcc acccacccag gattcaggag gagtgggggc tgctggaccg gtcacagaag gaactgtact gggatgcgat gctggagaag tacggcacag tggtctccct ggggttaccg ccccaccagc cagaggcaca ggcccagtca gagctgggga tgctgctcac ggggacaggc gtctgcagaa gcctgcgctc gggaaatgag agtgagggtc cacctggctg cccagaggcc cagccgcccc agggcccagg gccggcagcc tgggagggct tgtctggggc tgccactcct gcccccactg tgcgcccagg gacaccgcca gtgcccactc agcccacacc tgcagagacg agactggagc cggctgccac ccccaggaag ccctacacgt gcgagcagtg tggccgcggc ttcgactgga agtcagtgtt cgtcatccac caccggacac acacgagtgg gccaggtgtg cagtccccgg ggctagccac cggggaaagc acagagaagc caccacaagg ggaggtggcc tttccgcacc acccccgaca ctcactcaca ggcccccgga gttacccgtg tgaggagtgc gggtgcagct tcagctggaa gtcgcagctg gtcatccacc gcaagagcca ccggccggag gttccatga. It is sometimes possible for the material contained within the vial of "ZNF446, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
