Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF426 cdna clone

ZNF426 cDNA Clone

Gene Names
ZNF426; K-RBP
Synonyms
ZNF426; ZNF426 cDNA Clone; ZNF426 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagctgctgatttgtcccatggacattatctttctggggacccagtttgccttcatgaagaaaagacaccagcaggaagaatagtggctgactgcctaacagattgttatcaggattcagtgacctttgacgatgtggctgtggacttcacccaggaggagtggactttactggactcaactcagagaagcctctacagtgacgtgatgctggagaactacaagaacctggccacagtaggaggtcagatcatcaaacccagtctaatctcttggttggaacaagaagagtcaaggacagttcagggaggagttctccaaggatgggaaatgcgacttgaaacccagtggtctatacttcagcaggactttttgaggggtcagacatccattgggatacaattggaaggaaaacacaatggaagggaactctgtgactgtgagcaatgtggagaagtcttcagtgaacactcatgccttaagacgcacgtgagaactcaaagtacagggaacactcatgactgtaatcagtatggaaaagatttccttaccctgtgtgagaaaacctctactggtgagaaactttctgagtttaatcagagtgaaaaaatcttcagcctgacaccaaatattgtataccagagaactagcacacaagaaaagtcatttgaatgtagtcactgtggaaaatccttcattaatgagtcataccttcaggcacatatgagaactcacaatggagaaaaactctacgaatggaggaattatgggccaggttttattgactctacaagcctttctgtgcttatagaaaccctcaatgcaaaaaagccctacaaatgtaaggaatgtggaaaaggctatagatacccagcctacctcagtattcacatgcgaacccacactggggagaaaccatatgaatgtaaggaatgtgggaaagccttcaattattccaactcatttcagatacatggaagaactcacactggagagaaaccctatgtatgtaaggaatgtgggaaagccttcactcagtactcgggccttagtatgcatgtacgatctcacagtggagacaagccctatgaatgtaaggaatgtgggaaatccttccttacatcctcacgccttattcaacatataagaactcacactggagagaagccttttgtatgtgttgaatgtgggaaagcctttgcagtttcctcaaatcttagtggacatttgagaactcacactgaagagaaggcctgtgagtgtaagatatgtgggaaagtatttgggtatccctcatgtcttaataatcacatgcgaacgcacagtgcccagaaaccatacacctgtaaggaatgtgggaaggcttttaactattccacccaccttaaaattcacatgcgaatccacactggagaaaaaccctatgagtgtaaacaatgtggaaaggccttcagtcattccagttcatttcaaatacatgaaaggactcacactggagagaaaccctatgaatgcaaggagtgtgggaaagccttcacgtgttccagttcctttagaattcatgaaaaaactcacacagaagagaaaccctataaatgtcagcaatgcgggaaagcttacagtcatccccgttcacttcgaagacatgaacaaattcactag
Sequence Length
1665
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
63,106 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 426, mRNA
NCBI Official Synonym Full Names
zinc finger protein 426
NCBI Official Symbol
ZNF426
NCBI Official Synonym Symbols
K-RBP
NCBI Protein Information
zinc finger protein 426
UniProt Protein Name
Zinc finger protein 426
Protein Family
UniProt Gene Name
ZNF426
UniProt Entry Name
ZN426_HUMAN

NCBI Description

Kaposi's sarcoma-associated herpesvirus (KSHV) can be reactivated from latency by the viral protein RTA. The protein encoded by this gene is a zinc finger transcriptional repressor that interacts with RTA to modulate RTA-mediated reactivation of KSHV. While the encoded protein can repress KSHV reactivation, RTA can induce degradation of this protein through the ubiquitin-proteasome pathway to overcome the repression. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]

Uniprot Description

ZNF426: May be involved in transcriptional regulation.

Protein type: DNA-binding; C2H2-type zinc finger protein; Transcription regulation

Chromosomal Location of Human Ortholog: 19p13.2

Molecular Function: protein binding

Research Articles on ZNF426

Similar Products

Product Notes

The ZNF426 znf426 (Catalog #AAA1277358) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagctg ctgatttgtc ccatggacat tatctttctg gggacccagt ttgccttcat gaagaaaaga caccagcagg aagaatagtg gctgactgcc taacagattg ttatcaggat tcagtgacct ttgacgatgt ggctgtggac ttcacccagg aggagtggac tttactggac tcaactcaga gaagcctcta cagtgacgtg atgctggaga actacaagaa cctggccaca gtaggaggtc agatcatcaa acccagtcta atctcttggt tggaacaaga agagtcaagg acagttcagg gaggagttct ccaaggatgg gaaatgcgac ttgaaaccca gtggtctata cttcagcagg actttttgag gggtcagaca tccattggga tacaattgga aggaaaacac aatggaaggg aactctgtga ctgtgagcaa tgtggagaag tcttcagtga acactcatgc cttaagacgc acgtgagaac tcaaagtaca gggaacactc atgactgtaa tcagtatgga aaagatttcc ttaccctgtg tgagaaaacc tctactggtg agaaactttc tgagtttaat cagagtgaaa aaatcttcag cctgacacca aatattgtat accagagaac tagcacacaa gaaaagtcat ttgaatgtag tcactgtgga aaatccttca ttaatgagtc ataccttcag gcacatatga gaactcacaa tggagaaaaa ctctacgaat ggaggaatta tgggccaggt tttattgact ctacaagcct ttctgtgctt atagaaaccc tcaatgcaaa aaagccctac aaatgtaagg aatgtggaaa aggctataga tacccagcct acctcagtat tcacatgcga acccacactg gggagaaacc atatgaatgt aaggaatgtg ggaaagcctt caattattcc aactcatttc agatacatgg aagaactcac actggagaga aaccctatgt atgtaaggaa tgtgggaaag ccttcactca gtactcgggc cttagtatgc atgtacgatc tcacagtgga gacaagccct atgaatgtaa ggaatgtggg aaatccttcc ttacatcctc acgccttatt caacatataa gaactcacac tggagagaag ccttttgtat gtgttgaatg tgggaaagcc tttgcagttt cctcaaatct tagtggacat ttgagaactc acactgaaga gaaggcctgt gagtgtaaga tatgtgggaa agtatttggg tatccctcat gtcttaataa tcacatgcga acgcacagtg cccagaaacc atacacctgt aaggaatgtg ggaaggcttt taactattcc acccacctta aaattcacat gcgaatccac actggagaaa aaccctatga gtgtaaacaa tgtggaaagg ccttcagtca ttccagttca tttcaaatac atgaaaggac tcacactgga gagaaaccct atgaatgcaa ggagtgtggg aaagccttca cgtgttccag ttcctttaga attcatgaaa aaactcacac agaagagaaa ccctataaat gtcagcaatg cgggaaagct tacagtcatc cccgttcact tcgaagacat gaacaaattc actag. It is sometimes possible for the material contained within the vial of "ZNF426, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.