Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF410 cdna clone

ZNF410 cDNA Clone

Gene Names
ZNF410; APA1; APA-1
Synonyms
ZNF410; ZNF410 cDNA Clone; ZNF410 cdna clone
Ordering
For Research Use Only!
Sequence
atgttatcagatgagttagaatccaaaccagagctcctggtacagtttgttcagaatacgtccatcccattgggacaggggcttgtagaatcagaagctaaagatattacttgcttgtccctccttcccgtgactgaagcctcagaatgcagtcggctaatgttaccagatgatactacaaatcattctaactcctccaaggaggtcccttcctcagctgttttgagaagccttcgggtgaatgtgggtccagacggagaggagacgagagctcagactgtacagaaatccccggagtttttgtccacttcagagtcttctagcttgttgcaagatctacagccaagtgatagcacttcttttattcttcttaacctaacaagagcaggtctgggctcttcagctgagcacttagtgtttgtacaggatgaggcagaagattcagggaatgatttcctctccagtgagagcacagacagtagcattccatggttcctccgggttcaggagttggcccatgacagtttgattgctgctactcgtgcacaactggcaaagaatgcaaaaaccagcagcaatggagaaaatgtccaccttggttctggtgatgggcagtcaaaagattctgggccccttcctcaagtggaaaagaagctcaagtgtacagttgaaggttgtgaccggacatttgtatggccagctcactttaaataccacctcaagactcatcgaaatgaccgctccttcatctgtcctgcagaaggttgtgggaaaagcttctatgtgctgcagaggctgaaggtgcacatgaggacccacaatggagagaagccctttatgtgccatgagtctggctgtggtaagcagtttactacagctggaaacctgaagaaccaccggcgcatccacacaggagagaaacctttcctttgtgaagcccaaggatgtggccgttcctttgctgagtattctagcctccgaaaacatctggtggttcactcaggagagaagcctcatcagtgccaagtctgtgggaagaccttctctcagagtggaagcaggaatgtgcatatgagaaagcatcacctgcagctgggagcagctgggagtcaagagcaggagcaaactgaggtgcttgctgaaggatccccacgttccctgtcttcagtgcctgatgtgacacatcacctggtgaccatgcagtcagggaggcaatcatatgaagtttctgtcttaactgcagtaaatccacaagagttactaaaccaaggagatttaactgaaagacggacatga
Sequence Length
1296
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,829 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 410, mRNA
NCBI Official Synonym Full Names
zinc finger protein 410
NCBI Official Symbol
ZNF410
NCBI Official Synonym Symbols
APA1; APA-1
NCBI Protein Information
zinc finger protein 410
UniProt Protein Name
Zinc finger protein 410
Protein Family
UniProt Gene Name
ZNF410
UniProt Synonym Gene Names
APA1
UniProt Entry Name
ZN410_HUMAN

Uniprot Description

ZNF410: Transcription factor that activates transcription of matrix-remodeling genes such as MMP1 during fibroblast senescence. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: C2H2-type zinc finger protein; Transcription factor

Chromosomal Location of Human Ortholog: 14q24.3

Molecular Function: protein binding

Research Articles on ZNF410

Similar Products

Product Notes

The ZNF410 znf410 (Catalog #AAA1272936) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttatcag atgagttaga atccaaacca gagctcctgg tacagtttgt tcagaatacg tccatcccat tgggacaggg gcttgtagaa tcagaagcta aagatattac ttgcttgtcc ctccttcccg tgactgaagc ctcagaatgc agtcggctaa tgttaccaga tgatactaca aatcattcta actcctccaa ggaggtccct tcctcagctg ttttgagaag ccttcgggtg aatgtgggtc cagacggaga ggagacgaga gctcagactg tacagaaatc cccggagttt ttgtccactt cagagtcttc tagcttgttg caagatctac agccaagtga tagcacttct tttattcttc ttaacctaac aagagcaggt ctgggctctt cagctgagca cttagtgttt gtacaggatg aggcagaaga ttcagggaat gatttcctct ccagtgagag cacagacagt agcattccat ggttcctccg ggttcaggag ttggcccatg acagtttgat tgctgctact cgtgcacaac tggcaaagaa tgcaaaaacc agcagcaatg gagaaaatgt ccaccttggt tctggtgatg ggcagtcaaa agattctggg ccccttcctc aagtggaaaa gaagctcaag tgtacagttg aaggttgtga ccggacattt gtatggccag ctcactttaa ataccacctc aagactcatc gaaatgaccg ctccttcatc tgtcctgcag aaggttgtgg gaaaagcttc tatgtgctgc agaggctgaa ggtgcacatg aggacccaca atggagagaa gccctttatg tgccatgagt ctggctgtgg taagcagttt actacagctg gaaacctgaa gaaccaccgg cgcatccaca caggagagaa acctttcctt tgtgaagccc aaggatgtgg ccgttccttt gctgagtatt ctagcctccg aaaacatctg gtggttcact caggagagaa gcctcatcag tgccaagtct gtgggaagac cttctctcag agtggaagca ggaatgtgca tatgagaaag catcacctgc agctgggagc agctgggagt caagagcagg agcaaactga ggtgcttgct gaaggatccc cacgttccct gtcttcagtg cctgatgtga cacatcacct ggtgaccatg cagtcaggga ggcaatcata tgaagtttct gtcttaactg cagtaaatcc acaagagtta ctaaaccaag gagatttaac tgaaagacgg acatga. It is sometimes possible for the material contained within the vial of "ZNF410, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.