ZNF398 cdna clone
ZNF398 cDNA Clone
Gene Names
ZNF398; P51; P71; ZER6
Synonyms
ZNF398; ZNF398 cDNA Clone; ZNF398 cdna clone
Sequence
atggctgaggcggccccggccccgacatctgaatgggactccgagtgccttacatccctgcagccccttcctcttcctacacccccagcagcaaatgaggcacacctgcagacagcagctatctctctgtggacagtggtggccgccgtgcaggctatagagaggaaggtggagatccacagccggcgactcctacacctagaaggtcggacagggacagcagagaagaaactagccagctgtgaaaagacagttaccgagcttgggaaccagctggagggcaagtgggccgtgctgggaaccctgctgcaggagtacgggctgctgcagaggcggctggagaacttggagaacctgctgcgcaacaggaacttctggatcctgcggctccctccaggtattaagggagatatcccaaaggtgcctgtggcatttgatgatgtctccatctacttttccactccagagtgggaaaaattagaagaatggcaaaaggaactttacaagaatatcatgaagggcaactacgagtctctcatctccatggattatgctataaatcaacctgatgtcttatctcagattcaaccagaaggggaacataatacagaggaccaggcagggccagaggaaagtgagattcccacagaccccagtgaagagcctggtatttcaacatcagatattctgtcttggattaaacaagaagaagagcctcaggttggggccccaccggagtccaaggagagtgacgtgtacaaaagcacttatgctgatgaagagcttgtcatcaaagctgaaggccttgctagatcctcgttgtgccctgaggttccagtccctttctcttctccaccagcagcagcaaaggatgctttttcagatgtggctttcaaaagccagcagtctacatccatgacaccttttggacgtccagccactgacctgcctgaagcctctgagggacaagtgacttttactcagttgggtagctatcccctcccacctccagttggcgagcaggtgttctcatgccaccactgtggcaagaatctcagccaagacatgttgctgacccaccaatgtagccatgctactgagcaccccttaccctgtgcccagtgccctaagcactttactccacaggcggacctcagcagcacctcccaggaccatgccagcgagacaccccccacctgcccacactgtgccaggacttttactcacccatcaagacttacctaccatcttcgggtccataacagcactgagcgtcctttcccctgtcctgattgccccaagcgctttgctgaccaggctcgactcaccagccaccggagagctcatgcaagcgaaaggcccttccgctgtgcccagtgcggcaggagcttcagcttgaaaatcagcctcctgctccaccagcggggtcatgcacaagagcgccctttctcctgccctcagtgtggcattgacttcaacggccactcggccctgatccgccaccagatgatccacacaggcgagcgtccttacccctgcactgactgcagtaagagcttcatgcgcaaggagcacctgctgaaccaccggcggctgcacacaggcgagcggcccttcagttgtcctcactgtggcaagagcttcatccgcaagcaccacctaatgaaacaccagcgcatccacaccggggagcggccctacccctgctcctactgtggcaggagcttccgctacaaacagacactcaaggaccacctccgttcaggccacaatggaggctgtgggggtgatagtgacccatcaggtcagccacccaacccaccaggtcccctcataactgggcttgaaacttctggcctgggtgtcaacactgaaggtctagagaccaaccagtggtatggggaagggagtggagggggagttttgtaa
Sequence Length
1929
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
52,023 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 398, mRNA
NCBI Official Synonym Full Names
zinc finger protein 398
NCBI Official Symbol
ZNF398
NCBI Official Synonym Symbols
P51; P71; ZER6
NCBI Protein Information
zinc finger protein 398
UniProt Protein Name
Zinc finger protein 398
Protein Family
UniProt Gene Name
ZNF398
UniProt Synonym Gene Names
KIAA1339; ZER6
UniProt Entry Name
ZN398_HUMAN
NCBI Description
This gene encodes a member of the Kruppel family of C2H2-type zinc-finger transcription factor proteins. The encoded protein acts as a transcriptional activator. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described, but their full length sequence has not been determined. [provided by RefSeq, Jul 2008]
Uniprot Description
ZNF398: Function as a transcriptional activator. Belongs to the krueppel C2H2-type zinc-finger protein family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: C2H2-type zinc finger protein; DNA-binding
Chromosomal Location of Human Ortholog: 7q36.1
Molecular Function: protein binding
Similar Products
Product Notes
The ZNF398 znf398 (Catalog #AAA1271767) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgagg cggccccggc cccgacatct gaatgggact ccgagtgcct tacatccctg cagccccttc ctcttcctac acccccagca gcaaatgagg cacacctgca gacagcagct atctctctgt ggacagtggt ggccgccgtg caggctatag agaggaaggt ggagatccac agccggcgac tcctacacct agaaggtcgg acagggacag cagagaagaa actagccagc tgtgaaaaga cagttaccga gcttgggaac cagctggagg gcaagtgggc cgtgctggga accctgctgc aggagtacgg gctgctgcag aggcggctgg agaacttgga gaacctgctg cgcaacagga acttctggat cctgcggctc cctccaggta ttaagggaga tatcccaaag gtgcctgtgg catttgatga tgtctccatc tacttttcca ctccagagtg ggaaaaatta gaagaatggc aaaaggaact ttacaagaat atcatgaagg gcaactacga gtctctcatc tccatggatt atgctataaa tcaacctgat gtcttatctc agattcaacc agaaggggaa cataatacag aggaccaggc agggccagag gaaagtgaga ttcccacaga ccccagtgaa gagcctggta tttcaacatc agatattctg tcttggatta aacaagaaga agagcctcag gttggggccc caccggagtc caaggagagt gacgtgtaca aaagcactta tgctgatgaa gagcttgtca tcaaagctga aggccttgct agatcctcgt tgtgccctga ggttccagtc cctttctctt ctccaccagc agcagcaaag gatgcttttt cagatgtggc tttcaaaagc cagcagtcta catccatgac accttttgga cgtccagcca ctgacctgcc tgaagcctct gagggacaag tgacttttac tcagttgggt agctatcccc tcccacctcc agttggcgag caggtgttct catgccacca ctgtggcaag aatctcagcc aagacatgtt gctgacccac caatgtagcc atgctactga gcacccctta ccctgtgccc agtgccctaa gcactttact ccacaggcgg acctcagcag cacctcccag gaccatgcca gcgagacacc ccccacctgc ccacactgtg ccaggacttt tactcaccca tcaagactta cctaccatct tcgggtccat aacagcactg agcgtccttt cccctgtcct gattgcccca agcgctttgc tgaccaggct cgactcacca gccaccggag agctcatgca agcgaaaggc ccttccgctg tgcccagtgc ggcaggagct tcagcttgaa aatcagcctc ctgctccacc agcggggtca tgcacaagag cgccctttct cctgccctca gtgtggcatt gacttcaacg gccactcggc cctgatccgc caccagatga tccacacagg cgagcgtcct tacccctgca ctgactgcag taagagcttc atgcgcaagg agcacctgct gaaccaccgg cggctgcaca caggcgagcg gcccttcagt tgtcctcact gtggcaagag cttcatccgc aagcaccacc taatgaaaca ccagcgcatc cacaccgggg agcggcccta cccctgctcc tactgtggca ggagcttccg ctacaaacag acactcaagg accacctccg ttcaggccac aatggaggct gtgggggtga tagtgaccca tcaggtcagc cacccaaccc accaggtccc ctcataactg ggcttgaaac ttctggcctg ggtgtcaaca ctgaaggtct agagaccaac cagtggtatg gggaagggag tggaggggga gttttgtaa. It is sometimes possible for the material contained within the vial of "ZNF398, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
