Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF273 cdna clone

ZNF273 cDNA Clone

Gene Names
ZNF273; HZF9
Synonyms
ZNF273; ZNF273 cDNA Clone; ZNF273 cdna clone
Ordering
For Research Use Only!
Sequence
atgttagataactacagaaacctggtcttcctgggtattgctgtctctaagccagacctgatcacttgtctggagcaaggaaaagagccctgcaatatgaagagacatgcgatggtagccaaacccccagttgtgtgttctcattttgcccaagacctttggccaaagcagggcttaaaagattcttttcaaaaagtgatactgagaagatatggaaaatatggacatgagaatttacaattaagaaaaggctgtaaaagtgcggatgagcataaggtgcacaaaagaggttataatggacttaaccaatgtttgacaactacccagagcaaaatatttcaatgtgataaatatgttaaagtccttcataaattctcaaattcaaatatacataagaaaagacaaactggaaagaaacctttcaaatgtaaagaatgtggcaaatcatgttgcatactttcacaactaactcagcataagaaaactgctactagagtgaatttctacaaatgtaagacatgtggaaaagcctttaaccagttctcaaatcttactaaacataagataattcatcctgaagtgaatccctacaaatgtgaagaatgtggcaaagcctttaaccagtccttaactcttactaaacataaaaaaattcatactgaagagaaaccttacaaatgtgaagattgtggcaaagtctttagtgtattttcagtccttactaaacataagataattcatacaggaacaaaaccctacaattgtgaagaatgtggcaaaggctttagtatattctcaacccttactaaacataagataattcatactggagagaaaccctacaaatgcaatgaatgtggtaaagcctttaactggtcctcaactcttactaaacataagagaattcatactggagagaaaccctacaaatgtgaagaatgtggcaaagcttttaaccagtcctcaacccttactagacataagatagttcatactggagagaaaccctacaaatgtgaagaatgtggtaaagcctttaaacggtccacaactcttactaaacataagagaatttatactaaagagaaaccatacaaatgtgaagaatgtggaaaagcctttagtgtattctcaacccttactaaacataagataattcatactggagcaaaaccttacaaatgtgaagaatgtggcagtgcctttagggcattctcaacccttactgaacataagagagttcatactggagagaaaccttacaaatgcaatgaatgtggtaaagcctttaactggtcctcaactcttactaaacataagagaattcatactggagagaagccctacaaatgtgaagaatgtggcaaagcttttaaccggtcctcaaaccttactcgacataagaaaattcatactggagagaaaccatacaaacctaaaagatgtgacagtgcttttgacaacaccccaaacttttctagacataaaagaaatcatatgggtgagaaatcctag
Sequence Length
1515
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
58,045 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 273, mRNA
NCBI Official Synonym Full Names
zinc finger protein 273
NCBI Official Symbol
ZNF273
NCBI Official Synonym Symbols
HZF9
NCBI Protein Information
zinc finger protein 273
UniProt Protein Name
Zinc finger protein 273
Protein Family
UniProt Gene Name
ZNF273
UniProt Entry Name
ZN273_HUMAN

NCBI Description

This gene is a member of the krueppel C2H2-type zinc-finger protein family and encodes a protein with 13 C2H2-type zinc fingers and a KRAB domain. This nuclear protein is involved in transcriptional regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]

Uniprot Description

ZNF273: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding; Transcription regulation; C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 7q11.21

Cellular Component: nucleus

Molecular Function: protein binding

Biological Process: regulation of transcription, DNA-dependent

Similar Products

Product Notes

The ZNF273 znf273 (Catalog #AAA1267559) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttagata actacagaaa cctggtcttc ctgggtattg ctgtctctaa gccagacctg atcacttgtc tggagcaagg aaaagagccc tgcaatatga agagacatgc gatggtagcc aaacccccag ttgtgtgttc tcattttgcc caagaccttt ggccaaagca gggcttaaaa gattcttttc aaaaagtgat actgagaaga tatggaaaat atggacatga gaatttacaa ttaagaaaag gctgtaaaag tgcggatgag cataaggtgc acaaaagagg ttataatgga cttaaccaat gtttgacaac tacccagagc aaaatatttc aatgtgataa atatgttaaa gtccttcata aattctcaaa ttcaaatata cataagaaaa gacaaactgg aaagaaacct ttcaaatgta aagaatgtgg caaatcatgt tgcatacttt cacaactaac tcagcataag aaaactgcta ctagagtgaa tttctacaaa tgtaagacat gtggaaaagc ctttaaccag ttctcaaatc ttactaaaca taagataatt catcctgaag tgaatcccta caaatgtgaa gaatgtggca aagcctttaa ccagtcctta actcttacta aacataaaaa aattcatact gaagagaaac cttacaaatg tgaagattgt ggcaaagtct ttagtgtatt ttcagtcctt actaaacata agataattca tacaggaaca aaaccctaca attgtgaaga atgtggcaaa ggctttagta tattctcaac ccttactaaa cataagataa ttcatactgg agagaaaccc tacaaatgca atgaatgtgg taaagccttt aactggtcct caactcttac taaacataag agaattcata ctggagagaa accctacaaa tgtgaagaat gtggcaaagc ttttaaccag tcctcaaccc ttactagaca taagatagtt catactggag agaaacccta caaatgtgaa gaatgtggta aagcctttaa acggtccaca actcttacta aacataagag aatttatact aaagagaaac catacaaatg tgaagaatgt ggaaaagcct ttagtgtatt ctcaaccctt actaaacata agataattca tactggagca aaaccttaca aatgtgaaga atgtggcagt gcctttaggg cattctcaac ccttactgaa cataagagag ttcatactgg agagaaacct tacaaatgca atgaatgtgg taaagccttt aactggtcct caactcttac taaacataag agaattcata ctggagagaa gccctacaaa tgtgaagaat gtggcaaagc ttttaaccgg tcctcaaacc ttactcgaca taagaaaatt catactggag agaaaccata caaacctaaa agatgtgaca gtgcttttga caacacccca aacttttcta gacataaaag aaatcatatg ggtgagaaat cctag. It is sometimes possible for the material contained within the vial of "ZNF273, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.