Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF256 cdna clone

ZNF256 cDNA Clone

Gene Names
ZNF256; BMZF3; BMZF-3
Synonyms
ZNF256; ZNF256 cDNA Clone; ZNF256 cdna clone
Ordering
For Research Use Only!
Sequence
atgtttttgagcagctgcacatttgaagtatctgggaagcccttcacttgcaaggaggttgggaaggatttcctggtgagatcaagatttcttcagcaacaggctgctcacaccagaaagaagtcaaacagaaccaagagtgcagtggcctttcacagtgtaaaaaatcattacaactggggagaatgtgtgaaagctttcagctacaaacatgtacgtgttcagcaccagggagacctcattagggaaagatcttacatgtgcagtgaatgtgggaaatcttttagcacaagctgtagcctcagtgatcatttgagagttcacacttcagaaaagccttatacatgtggagaatgtgggaaatcctataggcaaagctctagccttattacgcaccgaagaattcacactggagtaagacctcatcaatgtgatgaatgtggaaaattatttaacaggaagtatgaccttcttatacatcagagagttcatactggagaaaggccttacaagtgcagtgaatgtgggaaatcctttagccatagctctagcctcattacacaccagagaattcatactggaatgaggccttatgagtgcagtgaatgtgggaaatcttttatccatagttctagccttattacacaccagagagttcacactggtacaaggccttatatgtgcagtgaatgtgggaaatcctttagccagagctgtcacctcattaaacaccggagacttcacattggagaagggccttatgagtgtagtgaatgtgggaaattgtttacttatagatctcgtttcttccaacaccagagagttcatactggagtaagatctcatgaatgtcatgaatgtggaaaattatttagcaggaaatttgacctcattgtacatgagagagttcacacaggagaaaggccatatgagtgcagtgaatgtggaaaatcctttacctgtaaatcctacctcatctcacactggaaagttcatactggagcaaggccttatgaatgtggggagtgtgggaaatcatttactcatagctctacgctccttcaacaccagagagttcacactggagaaaggccttatgagtgcaatgaatgtgggaagttttttagccagagctccagcctcattagacataggagaagtcacaccggagaaaggccttatgagtgcagtgagtgttggaaatcctttagtaaccactctagcctcgttaaacaccgaagagttcataccggagaaaggccttatgaatgcagtgaatgtggaaaatcctttagccagagctctaacctcactaatcaccagcgaattcacagtggggaaaggccttatgagtgtagtgactgtggaaaattttttaccttcaactccaacctcctaaaacatcagaacgttcacaagggataa
Sequence Length
1425
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
54,856 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 256, mRNA
NCBI Official Synonym Full Names
zinc finger protein 256
NCBI Official Symbol
ZNF256
NCBI Official Synonym Symbols
BMZF3; BMZF-3
NCBI Protein Information
zinc finger protein 256
UniProt Protein Name
Zinc finger protein 256
Protein Family
UniProt Gene Name
ZNF256
UniProt Synonym Gene Names
BMZF3; BMZF-3
UniProt Entry Name
ZN256_HUMAN

Uniprot Description

ZNF256: Transcriptional repressor that plays a role in cell proliferation. Requires TRIM28 for its activity. Belongs to the krueppel C2H2-type zinc-finger protein family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: C2H2-type zinc finger protein; DNA-binding

Chromosomal Location of Human Ortholog: 19q13.43

Cellular Component: nucleus

Molecular Function: protein binding; transcription factor activity

Biological Process: multicellular organismal development; negative regulation of transcription, DNA-dependent

Research Articles on ZNF256

Similar Products

Product Notes

The ZNF256 znf256 (Catalog #AAA1268520) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtttttga gcagctgcac atttgaagta tctgggaagc ccttcacttg caaggaggtt gggaaggatt tcctggtgag atcaagattt cttcagcaac aggctgctca caccagaaag aagtcaaaca gaaccaagag tgcagtggcc tttcacagtg taaaaaatca ttacaactgg ggagaatgtg tgaaagcttt cagctacaaa catgtacgtg ttcagcacca gggagacctc attagggaaa gatcttacat gtgcagtgaa tgtgggaaat cttttagcac aagctgtagc ctcagtgatc atttgagagt tcacacttca gaaaagcctt atacatgtgg agaatgtggg aaatcctata ggcaaagctc tagccttatt acgcaccgaa gaattcacac tggagtaaga cctcatcaat gtgatgaatg tggaaaatta tttaacagga agtatgacct tcttatacat cagagagttc atactggaga aaggccttac aagtgcagtg aatgtgggaa atcctttagc catagctcta gcctcattac acaccagaga attcatactg gaatgaggcc ttatgagtgc agtgaatgtg ggaaatcttt tatccatagt tctagcctta ttacacacca gagagttcac actggtacaa ggccttatat gtgcagtgaa tgtgggaaat cctttagcca gagctgtcac ctcattaaac accggagact tcacattgga gaagggcctt atgagtgtag tgaatgtggg aaattgttta cttatagatc tcgtttcttc caacaccaga gagttcatac tggagtaaga tctcatgaat gtcatgaatg tggaaaatta tttagcagga aatttgacct cattgtacat gagagagttc acacaggaga aaggccatat gagtgcagtg aatgtggaaa atcctttacc tgtaaatcct acctcatctc acactggaaa gttcatactg gagcaaggcc ttatgaatgt ggggagtgtg ggaaatcatt tactcatagc tctacgctcc ttcaacacca gagagttcac actggagaaa ggccttatga gtgcaatgaa tgtgggaagt tttttagcca gagctccagc ctcattagac ataggagaag tcacaccgga gaaaggcctt atgagtgcag tgagtgttgg aaatccttta gtaaccactc tagcctcgtt aaacaccgaa gagttcatac cggagaaagg ccttatgaat gcagtgaatg tggaaaatcc tttagccaga gctctaacct cactaatcac cagcgaattc acagtgggga aaggccttat gagtgtagtg actgtggaaa attttttacc ttcaactcca acctcctaaa acatcagaac gttcacaagg gataa. It is sometimes possible for the material contained within the vial of "ZNF256, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.