ZNF239 cdna clone
ZNF239 cDNA Clone
Gene Names
ZNF239; MOK2; HOK-2
Synonyms
ZNF239; ZNF239 cDNA Clone; ZNF239 cdna clone
Sequence
atggccagtacaattactggaagtcaggattgtattgtgaatcatcgaggggaagtggatggggagcctgaactagatatttccccttgtcaacagtggggagaagcatcttctcctatttccagaaacagggacagtgtgatgactcttcaaagtggttgtttcgaaaacattgaaagtgaaacatatttgcctttgaaagtctcaagccaaatagacacacaagactcttcagtgaagttctgtaagaatgagcctcaggatcatcaggaaagcagacgtctctttgtaatggaagaaagcactgagagaaaagtgataaagggggaaagttgttcagagaaccttcaagttaaactggtgtctgatggacaagaactggcctcgccattgttaaatggtgaggcaacttgccagaatggccagttaaaagaatctttggatcccattgactgtaactgcaaagacattcatggatggaaatcacaggtggtcagttgtagtcagcagagagctcatacagaggagaaaccctgtgaccataataactgtgggaaaatacttaacaccagcccagatggtcatccatatgagaaaatccacactgcagagaaacaatacgaatgtagtcagtgtggtaagaacttcagtcaaagctcagagctactacttcatcagagagaccacacagaagaaaaaccctacaaatgtgagcaatgtgggaagggcttcacaaggagctcgagtctgcttatccatcaggcagtccacacagatgagaagccttataagtgtgacaagtgtgggaagggcttcaccaggagctcaagtctgctcatccatcatgccgtccatacaggcgaaaaaccttataaatgtgacaagtgtgggaagggctttagtcagagctccaaactgcacatccaccagcgagtccacactggagagaagccctatgagtgtgaggagtgtggtatgagcttcagtcagcgctcaaacctgcacatccaccagcgagtacacacaggagagaggccctacaagtgtggtgagtgtgggaagggcttcagtcagagctcgaaccttcacattcaccggtgcatccacacaggagagaagccttaccaatgctatgagtgtgggaagggtttcagccagagctcggatcttcgcatccatctcagagtccacactggagagaagccctatcactgtggcaagtgtgggaagggatttagccagagttccaaactcctcatccaccagagagtacatactggagagaagccctatgagtgcagcaagtgtgggaagggcttcagccagagctccaaccttcacatccaccagcgggttcacaagaaagatcctcgctaa
Sequence Length
1377
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
51,591 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 239, mRNA
NCBI Official Synonym Full Names
zinc finger protein 239
NCBI Official Symbol
ZNF239
NCBI Official Synonym Symbols
MOK2; HOK-2
NCBI Protein Information
zinc finger protein 239
UniProt Protein Name
Zinc finger protein 239
Protein Family
UniProt Gene Name
ZNF239
UniProt Synonym Gene Names
HOK2; MOK2
UniProt Entry Name
ZN239_HUMAN
NCBI Description
MOK2 proteins are DNA- and RNA-binding proteins that are mainly associated with nuclear RNP components, including the nucleoli and extranucleolar structures (Arranz et al., 1997 [PubMed 9121460]).[supplied by OMIM, Mar 2008]
Uniprot Description
ZNF239: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family.
Protein type: C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 10q11.22-q11.23
Molecular Function: protein binding; transcription factor activity
Biological Process: regulation of transcription, DNA-dependent
Research Articles on ZNF239
1. Observational study and genome-wide association study of gene-disease association. (HuGE Navigator)
Similar Products
Product Notes
The ZNF239 znf239 (Catalog #AAA1278317) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccagta caattactgg aagtcaggat tgtattgtga atcatcgagg ggaagtggat ggggagcctg aactagatat ttccccttgt caacagtggg gagaagcatc ttctcctatt tccagaaaca gggacagtgt gatgactctt caaagtggtt gtttcgaaaa cattgaaagt gaaacatatt tgcctttgaa agtctcaagc caaatagaca cacaagactc ttcagtgaag ttctgtaaga atgagcctca ggatcatcag gaaagcagac gtctctttgt aatggaagaa agcactgaga gaaaagtgat aaagggggaa agttgttcag agaaccttca agttaaactg gtgtctgatg gacaagaact ggcctcgcca ttgttaaatg gtgaggcaac ttgccagaat ggccagttaa aagaatcttt ggatcccatt gactgtaact gcaaagacat tcatggatgg aaatcacagg tggtcagttg tagtcagcag agagctcata cagaggagaa accctgtgac cataataact gtgggaaaat acttaacacc agcccagatg gtcatccata tgagaaaatc cacactgcag agaaacaata cgaatgtagt cagtgtggta agaacttcag tcaaagctca gagctactac ttcatcagag agaccacaca gaagaaaaac cctacaaatg tgagcaatgt gggaagggct tcacaaggag ctcgagtctg cttatccatc aggcagtcca cacagatgag aagccttata agtgtgacaa gtgtgggaag ggcttcacca ggagctcaag tctgctcatc catcatgccg tccatacagg cgaaaaacct tataaatgtg acaagtgtgg gaagggcttt agtcagagct ccaaactgca catccaccag cgagtccaca ctggagagaa gccctatgag tgtgaggagt gtggtatgag cttcagtcag cgctcaaacc tgcacatcca ccagcgagta cacacaggag agaggcccta caagtgtggt gagtgtggga agggcttcag tcagagctcg aaccttcaca ttcaccggtg catccacaca ggagagaagc cttaccaatg ctatgagtgt gggaagggtt tcagccagag ctcggatctt cgcatccatc tcagagtcca cactggagag aagccctatc actgtggcaa gtgtgggaag ggatttagcc agagttccaa actcctcatc caccagagag tacatactgg agagaagccc tatgagtgca gcaagtgtgg gaagggcttc agccagagct ccaaccttca catccaccag cgggttcaca agaaagatcc tcgctaa. It is sometimes possible for the material contained within the vial of "ZNF239, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
