ZNF219 cdna clone
ZNF219 cDNA Clone
Gene Names
ZNF219; ZFP219
Synonyms
ZNF219; ZNF219 cDNA Clone; ZNF219 cdna clone
Sequence
atggagggctcacgtccccgcgccccgagcggccacttagcgccgtcgccgccggctttcgacggcgagctggatctgcagcgatactccaacgggccagccgtgagcgcagggtcgctcgggatgggagcggtgagctggtctgagagtcgtgcaggcgaacggcgcttcccctgccctgtatgcgggaagcgcttccgcttcaactctatccttgctttgcacctgcgggcgcacccaggagcccaggccttccagtgccctcactgcggccaccgcgcggcgcagcgggctctgctgcgctcgcacctgcgcacacaccagcccgagcgcccacgtagtcctgctgcacgcctgttgctggagttggaagagcgcgcgctactacgcgaggcccgactggggagagcccgaagctcagggggcatgcaggccacccctgccactgagggtctggcgcggccccaggctccttcatcgtccgccttccgttgcccctactgcaaaggcaagtttcgcacctcggcggagcgcgaacgccacctgcacatcctgcataggccctggaagtgcggcctgtgcagtttcggctccagccaggaggaggagctgctgcaccacagcctgacggcccacggggctcccgagcgtcccctggcggccacctccgctgcgcctccgcctcagcctcagcctcagcctccaccccagcccgaacccagatcagtcccccagccggagccggagccggagcccgaacgtgaggcaaccccgaccacagctcctgccgctcccgaggagcccccagcgcctccggagttccgctgccaagtgtgcggccagagctttacacagtcttggtttctcaagggccacatgcgtaagcacaaggcctccttcgatcatgcgtgtccggtgtgcggccgctgcttcaaggagccctggttccttaagaaccacatgaaggtgcacgccagcaagctgggcccactgcgtgccccggggcctgcctccgggcctgcccgcgccccccagcctcctgacctcggcctgctggcctatgagccgttgggcccagcgctcctcttggccccggctcccaccccggccgagcgccgtgagcccccgagcctcttgggctacctgagcctgcgagctggcgagggccggcccaacggcgagggtgctgagcccggtcccggccgcagcttcggaggcttccgcccgctgtcctctgctctcccggcccgggctcgccggcaccgtgcggaggagcctgaggaagaagaggaggtggtggaggccgaggaggaaacctgggcccggggcaggtcgctgggctctctggcttccctgcacccgcgcccgggtgagggaccggggcactctgcctctgctgctggggcccaggcaagatcgaccgccacgcaggaagagaatgggctgttggttggagggacccggcctgaagggggccggggcgccaccggcaaggattgtcctttctgcggaaaatctttccgctcagcacatcacctcaaagtgcatctgcgagtgcacacaggcgagcggccctacaagtgtccgcactgcgactacgcgggcacccagtccggctcgctcaagtatcacctacagcgccaccaccgggagcagaggagcggggccggccccgggccacccccggagccaccgcctccttcccagcggggttcggccccgcaatctggagccaagccgtctccgcagcctgcgacctgggtggagggcgcctcaagtccccggcctccttctagcggtgctgggccggggtcccgtcggaagcccgccagccctgggaggaccctgcgcaacgggcgaggcggtgaggccgaacccctggacctgtccttgcgggcagggccgggaggcgaggccgggcctgggggtgccctccaccgctgcctcttctgcccgttcgccactggagccccagagctcatggccttgcaccttcaagtgcaccacagccgccgggctaggggccgccggccaccccaggctgacgcgtccccgccctatgcccgagtaccatcaggagagacccctcccagtccttcgcaggaaggggaggagggctccgggctgtccagacccggagaggcagggctgggggggcaagaacggtag
Sequence Length
2169
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
76,877 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 219, mRNA
NCBI Official Synonym Full Names
zinc finger protein 219
NCBI Official Symbol
ZNF219
NCBI Official Synonym Symbols
ZFP219
NCBI Protein Information
zinc finger protein 219
UniProt Protein Name
Zinc finger protein 219
Protein Family
UniProt Gene Name
ZNF219
UniProt Entry Name
ZN219_HUMAN
Uniprot Description
ZNF219: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family.
Protein type: C2H2-type zinc finger protein; Transcription factor; DNA-binding
Chromosomal Location of Human Ortholog: 14q11
Cellular Component: nucleus
Molecular Function: DNA binding; protein binding; transcription factor activity
Biological Process: multicellular organismal development; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; regulation of transcription, DNA-dependent; signal transduction; transcription, DNA-dependent
Research Articles on ZNF219
Similar Products
Product Notes
The ZNF219 znf219 (Catalog #AAA1273395) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagggct cacgtccccg cgccccgagc ggccacttag cgccgtcgcc gccggctttc gacggcgagc tggatctgca gcgatactcc aacgggccag ccgtgagcgc agggtcgctc gggatgggag cggtgagctg gtctgagagt cgtgcaggcg aacggcgctt cccctgccct gtatgcggga agcgcttccg cttcaactct atccttgctt tgcacctgcg ggcgcaccca ggagcccagg ccttccagtg ccctcactgc ggccaccgcg cggcgcagcg ggctctgctg cgctcgcacc tgcgcacaca ccagcccgag cgcccacgta gtcctgctgc acgcctgttg ctggagttgg aagagcgcgc gctactacgc gaggcccgac tggggagagc ccgaagctca gggggcatgc aggccacccc tgccactgag ggtctggcgc ggccccaggc tccttcatcg tccgccttcc gttgccccta ctgcaaaggc aagtttcgca cctcggcgga gcgcgaacgc cacctgcaca tcctgcatag gccctggaag tgcggcctgt gcagtttcgg ctccagccag gaggaggagc tgctgcacca cagcctgacg gcccacgggg ctcccgagcg tcccctggcg gccacctccg ctgcgcctcc gcctcagcct cagcctcagc ctccacccca gcccgaaccc agatcagtcc cccagccgga gccggagccg gagcccgaac gtgaggcaac cccgaccaca gctcctgccg ctcccgagga gcccccagcg cctccggagt tccgctgcca agtgtgcggc cagagcttta cacagtcttg gtttctcaag ggccacatgc gtaagcacaa ggcctccttc gatcatgcgt gtccggtgtg cggccgctgc ttcaaggagc cctggttcct taagaaccac atgaaggtgc acgccagcaa gctgggccca ctgcgtgccc cggggcctgc ctccgggcct gcccgcgccc cccagcctcc tgacctcggc ctgctggcct atgagccgtt gggcccagcg ctcctcttgg ccccggctcc caccccggcc gagcgccgtg agcccccgag cctcttgggc tacctgagcc tgcgagctgg cgagggccgg cccaacggcg agggtgctga gcccggtccc ggccgcagct tcggaggctt ccgcccgctg tcctctgctc tcccggcccg ggctcgccgg caccgtgcgg aggagcctga ggaagaagag gaggtggtgg aggccgagga ggaaacctgg gcccggggca ggtcgctggg ctctctggct tccctgcacc cgcgcccggg tgagggaccg gggcactctg cctctgctgc tggggcccag gcaagatcga ccgccacgca ggaagagaat gggctgttgg ttggagggac ccggcctgaa gggggccggg gcgccaccgg caaggattgt cctttctgcg gaaaatcttt ccgctcagca catcacctca aagtgcatct gcgagtgcac acaggcgagc ggccctacaa gtgtccgcac tgcgactacg cgggcaccca gtccggctcg ctcaagtatc acctacagcg ccaccaccgg gagcagagga gcggggccgg ccccgggcca cccccggagc caccgcctcc ttcccagcgg ggttcggccc cgcaatctgg agccaagccg tctccgcagc ctgcgacctg ggtggagggc gcctcaagtc cccggcctcc ttctagcggt gctgggccgg ggtcccgtcg gaagcccgcc agccctggga ggaccctgcg caacgggcga ggcggtgagg ccgaacccct ggacctgtcc ttgcgggcag ggccgggagg cgaggccggg cctgggggtg ccctccaccg ctgcctcttc tgcccgttcg ccactggagc cccagagctc atggccttgc accttcaagt gcaccacagc cgccgggcta ggggccgccg gccaccccag gctgacgcgt ccccgcccta tgcccgagta ccatcaggag agacccctcc cagtccttcg caggaagggg aggagggctc cgggctgtcc agacccggag aggcagggct gggggggcaa gaacggtag. It is sometimes possible for the material contained within the vial of "ZNF219, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
