Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF193 cdna clone

ZNF193 cDNA Clone

Gene Names
ZSCAN9; PRD51; ZNF193
Synonyms
ZNF193; ZNF193 cDNA Clone; ZNF193 cdna clone
Ordering
For Research Use Only!
Sequence
atgaatacaaactcaaaggaggttttatccctgggtgttcaagttcccgaggcatgggaagaacttctgacaatgaaagtggaagcaaaaagtcaccttcaatggcaggaatccagactgaaacgcagtaatccactggcaagggaaatcttccgaaggcactttcgacagctgtgctaccaagagacccctggaccaagggaggctcttactcgactccaggaactttgctaccagtggttgaggccacatgtgagcacaaaggagcagattttggatctgctggtgctggagcagtttctatccattctgcccaaggagctccagggctgggtgagggaacactgtccagagagtggagaagaggctgtgattttgctggaggatctggagagagagctcgatgaaccacaacatgagatggtggcccacagacacagacaagaagtcctctgtaaagagatggtgcctctagcagagcagacaccactgacccttcagtcccagcctaaggagccacagctcacatgtgactctgctcagaagtgccattctattggagagacagatgaagtaaccaagactgaggacagagagttggtgctaaggaaagactgtcctaagatagtggaaccacatgggaaaatgtttaatgagcagacctgggaggtatcacagcaggatccctcacatggagaagttggtgaacataaggataggatagagaggcagtggggaaacctcttaggagaggggcaacacaaatgtgatgaatgtgggaagagctttactcagagctcaggtctcattcgacatcaaagaattcatactggagaaagaccttatgaatgtaatgaatgtgggaaagccttcagtcgaagttctggtctttttaatcaccgaggaatccacaatatacagaaacggtaccactgcaaggagtgtgggaaggtcttcagtcagagtgcgggtcttatccagcatcagagaatccacaaaggagaaaagccgtatcagtgcagccagtgcagtaagagctacagtcggcgttcatttctcattgaacatcagagaagccacacaggggagcgacctcaccagtgcattgaatgtgggaaaagctttaatcgacactgcaacctcattcgccatcagaagatccacacagtggctgagctggtctag
Sequence Length
1185
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,650 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 193, mRNA
NCBI Official Synonym Full Names
zinc finger and SCAN domain containing 9
NCBI Official Symbol
ZSCAN9
NCBI Official Synonym Symbols
PRD51; ZNF193
NCBI Protein Information
zinc finger and SCAN domain-containing protein 9
UniProt Protein Name
Zinc finger and SCAN domain-containing protein 9
UniProt Gene Name
ZSCAN9
UniProt Synonym Gene Names
ZNF193
UniProt Entry Name
ZSC9_HUMAN

Uniprot Description

ZNF193: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family.

Protein type: DNA-binding; C2H2-type zinc finger protein; Transcription factor

Chromosomal Location of Human Ortholog: 6p21.3

Cellular Component: nucleus

Molecular Function: protein binding; sequence-specific DNA binding; transcription factor activity

Similar Products

Product Notes

The ZNF193 zscan9 (Catalog #AAA1267359) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatacaa actcaaagga ggttttatcc ctgggtgttc aagttcccga ggcatgggaa gaacttctga caatgaaagt ggaagcaaaa agtcaccttc aatggcagga atccagactg aaacgcagta atccactggc aagggaaatc ttccgaaggc actttcgaca gctgtgctac caagagaccc ctggaccaag ggaggctctt actcgactcc aggaactttg ctaccagtgg ttgaggccac atgtgagcac aaaggagcag attttggatc tgctggtgct ggagcagttt ctatccattc tgcccaagga gctccagggc tgggtgaggg aacactgtcc agagagtgga gaagaggctg tgattttgct ggaggatctg gagagagagc tcgatgaacc acaacatgag atggtggccc acagacacag acaagaagtc ctctgtaaag agatggtgcc tctagcagag cagacaccac tgacccttca gtcccagcct aaggagccac agctcacatg tgactctgct cagaagtgcc attctattgg agagacagat gaagtaacca agactgagga cagagagttg gtgctaagga aagactgtcc taagatagtg gaaccacatg ggaaaatgtt taatgagcag acctgggagg tatcacagca ggatccctca catggagaag ttggtgaaca taaggatagg atagagaggc agtggggaaa cctcttagga gaggggcaac acaaatgtga tgaatgtggg aagagcttta ctcagagctc aggtctcatt cgacatcaaa gaattcatac tggagaaaga ccttatgaat gtaatgaatg tgggaaagcc ttcagtcgaa gttctggtct ttttaatcac cgaggaatcc acaatataca gaaacggtac cactgcaagg agtgtgggaa ggtcttcagt cagagtgcgg gtcttatcca gcatcagaga atccacaaag gagaaaagcc gtatcagtgc agccagtgca gtaagagcta cagtcggcgt tcatttctca ttgaacatca gagaagccac acaggggagc gacctcacca gtgcattgaa tgtgggaaaa gctttaatcg acactgcaac ctcattcgcc atcagaagat ccacacagtg gctgagctgg tctag. It is sometimes possible for the material contained within the vial of "ZNF193, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.