ZMYND10 cdna clone

ZMYND10 cDNA Clone

Gene Names

ZMYND10; BLU; FLU; CILD22

Synonyms

ZMYND10; ZMYND10 cDNA Clone; ZMYND10 cdna clone

Ordering
Cat. Num. AAA1265823 For Research Use Only!

Sequence

atgggagacctggaactgctgctgcccggggaagctgaagtgctggtgcggggtctgcgcagcttcccgctacgcgagatgggctccgaagggtggaaccagcagcatgagaacctggagaagctgaacatgcaagccatcctcgatgccacagtcagccagggcgagcccattcaggagctgctggtcacccatgggaaggtcccaacactggtggaggagctgatcgcagtggagatgtggaagcagaaggtgttccctgtgttctgcagggtggaggacttcaagccccagaacaccttccccatctacatggtggtgcaccacgaggcctccatcatcaacctcttggagacagtgttcttccacaaggaggtgtgtgagtcagcagaagacactgtcttggacttggtagactattgccaccgcaaactgaccctgctggtggcccagagtggctgtggtggcccccctgagggggagggatcccaggacagcaaccccatgcaggagctgcagaagcaggcagagctgatggaatttgagattgcactgaaggccctctcagtactacgctacatcacagactgtgtggacagcctctctctcagcaccttgagccgtatgcttagcacacacaacctgccctgcctcctggtggaactgctggagcatagtccctggagccggcgggaaggaggcaagctgcagcagttcgagggcagccgttggcatactgtggccccctcagagcagcaaaagctgagcaagttggacgggcaagtgtggatcgccctgtacaacctgctgctaagccctgaggctcaggcgcgctactgcctcacaagttttgccaagggacggctactcaagcttcgggccttcctcacagacacactgctggaccagctgcccaacctggcccacttgcagagtttcctggcccatctgaccctaactgaaacccagcctcctaagaaggacctggtgttggaacagatcccagaaatctgggagcggctggagcgagaaaacagaggcaagtggcaggcaattgccaagcaccagctccagcatgtgttcagcccctcagagcaggacctgcggctgcaggcgcgaaggtgggctgagacctacaggctggatgtgctagaggcagtggctccagagcggccccgctgtgcttactgcagtgcagaggcttctaagcgctgctcacgatgccagaatgagtggtattgctgcagggagtgccaagtcaagcactgggaaaagcatggaaagacttgtgtcctggcagcccagggtgacagagccaaatga

Sequence Length

1323

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

21707133

NCBI GeneID

51364

Molecular Weight

49,989 Da

NCBI Official Full Name

Homo sapiens zinc finger, MYND-type containing 10, mRNA

NCBI Official Synonym Full Names

zinc finger MYND-type containing 10

NCBI Official Symbol

ZMYND10

NCBI Official Synonym Symbols

BLU; FLU; CILD22

NCBI Protein Information

zinc finger MYND domain-containing protein 10

UniProt Protein Name

Zinc finger MYND domain-containing protein 10

Protein Family

Zinc finger MYND domain-containing protein

UniProt Gene Name

ZMYND10

UniProt Synonym Gene Names

BLU

UniProt Entry Name

ZMY10_HUMAN

NCBI Description

This gene encodes a protein containing a MYND-type zinc finger domain that likely functions in assembly of the dynein motor. Mutations in this gene can cause primary ciliary dyskinesia. This gene is also considered a tumor suppressor gene and is often mutated, deleted, or hypermethylated and silenced in cancer cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]

Uniprot Description

ZMYND10: 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 3p21.3

Cellular Component: cytoplasm

Molecular Function: protein binding

Disease: Ciliary Dyskinesia, Primary, 22

Research Articles on ZMYND10

1. A novel frameshift mutation (c.367delC) in ZMYND10, unique for Slavic primary ciliary dyskinesia population (PCD), was found in homozygous state in two unrelated PCD patients.

Similar Products

Product Notes

The ZMYND10 zmynd10 (Catalog #AAA1265823) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggagacc tggaactgct gctgcccggg gaagctgaag tgctggtgcg gggtctgcgc agcttcccgc tacgcgagat gggctccgaa gggtggaacc agcagcatga gaacctggag aagctgaaca tgcaagccat cctcgatgcc acagtcagcc agggcgagcc cattcaggag ctgctggtca cccatgggaa ggtcccaaca ctggtggagg agctgatcgc agtggagatg tggaagcaga aggtgttccc tgtgttctgc agggtggagg acttcaagcc ccagaacacc ttccccatct acatggtggt gcaccacgag gcctccatca tcaacctctt ggagacagtg ttcttccaca aggaggtgtg tgagtcagca gaagacactg tcttggactt ggtagactat tgccaccgca aactgaccct gctggtggcc cagagtggct gtggtggccc ccctgagggg gagggatccc aggacagcaa ccccatgcag gagctgcaga agcaggcaga gctgatggaa tttgagattg cactgaaggc cctctcagta ctacgctaca tcacagactg tgtggacagc ctctctctca gcaccttgag ccgtatgctt agcacacaca acctgccctg cctcctggtg gaactgctgg agcatagtcc ctggagccgg cgggaaggag gcaagctgca gcagttcgag ggcagccgtt ggcatactgt ggccccctca gagcagcaaa agctgagcaa gttggacggg caagtgtgga tcgccctgta caacctgctg ctaagccctg aggctcaggc gcgctactgc ctcacaagtt ttgccaaggg acggctactc aagcttcggg ccttcctcac agacacactg ctggaccagc tgcccaacct ggcccacttg cagagtttcc tggcccatct gaccctaact gaaacccagc ctcctaagaa ggacctggtg ttggaacaga tcccagaaat ctgggagcgg ctggagcgag aaaacagagg caagtggcag gcaattgcca agcaccagct ccagcatgtg ttcagcccct cagagcagga cctgcggctg caggcgcgaa ggtgggctga gacctacagg ctggatgtgc tagaggcagt ggctccagag cggccccgct gtgcttactg cagtgcagag gcttctaagc gctgctcacg atgccagaat gagtggtatt gctgcaggga gtgccaagtc aagcactggg aaaagcatgg aaagacttgt gtcctggcag cccagggtga cagagccaaa tga. It is sometimes possible for the material contained within the vial of "ZMYND10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

ZMYND10 cdna clone