ZMYM6 cdna clone
ZMYM6 cDNA Clone
Gene Names
ZMYM6; MYM; ZBED7; ZNF258; Buster2; ZNF198L4
Synonyms
ZMYM6; ZMYM6 cDNA Clone; ZMYM6 cdna clone
Sequence
atgaaagaacctttggatggtgaatgtggcaaagcagtggtaccacagcaggagcttctggacaaaattaaagaagaaccagacaatgctcaagagtatggatgtgtccaacagccaaaaactcaagaaagtaaattgaaaattggtggtgtgtcttcagttaatgagagacctattgcccagcagttgaacccaggctttcagctttcttttgcatcatctggcccaagtgtgttgcttccttcagttccagctgttgctattaaggttttttgttctggttgtaaaaaaatgctttataagggccaaactgcatatcataagacaggatctactcagctcttctgctccacacgatgcatcaccagacattcttcacctgcctgcctgccacctcctcccaagaaaacctgcacaaactgctcgaagtataaaattcttaacatccctttttactttacctttttttag
Sequence Length
471
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
73,255 Da
NCBI Official Full Name
Homo sapiens zinc finger, MYM-type 6, mRNA
NCBI Official Synonym Full Names
zinc finger MYM-type containing 6
NCBI Official Symbol
ZMYM6
NCBI Official Synonym Symbols
MYM; ZBED7; ZNF258; Buster2; ZNF198L4
NCBI Protein Information
zinc finger MYM-type protein 6
UniProt Protein Name
Zinc finger MYM-type protein 6
Protein Family
UniProt Gene Name
ZMYM6
UniProt Synonym Gene Names
Buster2; KIAA1353; ZNF258
UniProt Entry Name
ZMYM6_HUMAN
Uniprot Description
ZMYM6: Plays a role in the regulation of cell morphology and cytoskeletal organization. 5 isoforms of the human protein are produced by alternative splicing.
Protein type: DNA-binding
Chromosomal Location of Human Ortholog: 1p34.2
Cellular Component: cytoplasm; nucleoplasm
Molecular Function: DNA binding
Biological Process: cytoskeleton organization and biogenesis; multicellular organismal development; regulation of cell morphogenesis
Similar Products
Product Notes
The ZMYM6 zmym6 (Catalog #AAA1274479) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaagaac ctttggatgg tgaatgtggc aaagcagtgg taccacagca ggagcttctg gacaaaatta aagaagaacc agacaatgct caagagtatg gatgtgtcca acagccaaaa actcaagaaa gtaaattgaa aattggtggt gtgtcttcag ttaatgagag acctattgcc cagcagttga acccaggctt tcagctttct tttgcatcat ctggcccaag tgtgttgctt ccttcagttc cagctgttgc tattaaggtt ttttgttctg gttgtaaaaa aatgctttat aagggccaaa ctgcatatca taagacagga tctactcagc tcttctgctc cacacgatgc atcaccagac attcttcacc tgcctgcctg ccacctcctc ccaagaaaac ctgcacaaac tgctcgaagt ataaaattct taacatccct ttttacttta ccttttttta g. It is sometimes possible for the material contained within the vial of "ZMYM6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
