Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZMYM3 cdna clone

ZMYM3 cDNA Clone

Gene Names
ZMYM3; MYM; XFIM; ZNF261; DXS6673E; ZNF198L2
Synonyms
ZMYM3; ZMYM3 cDNA Clone; ZMYM3 cdna clone
Ordering
For Research Use Only!
Sequence
atggaccccagtgatttccccagtccatttgacccattgaccctgccagagaagcccctggctggagacctaccagtagacatggaatttggagaggatctactggaatcccagactgccccaactcgaggatgggccccccctggcccttctccatcctcgggagccctggacctgcttgatacccctgctggcctggaaaaagaccctggagtcctggatggagccactgagttgctggggctgggggggctgctctataaagccccctctcccccggaggtggaccacggtcctgagggaaccctggcatgggatgcaggagatcagaccctagagcctggaccagggggccagacccctgaggtggtaccacctgatccaggggctggggcaaattcctgttcacctgaggggctactagagcctttggctccagattctccaataacactgcagtccccacatattgaagaggaggagaccacctccatagctactgcaagaaggggctcccctgggcaggaggaggagcttccccaagggcagccacagagcccaaatgccccgcctagcccttcagtgggagagactctgggggatggaatcaacagttctcagaccaaacctgggggctctagcccccctgcacatccttccttgccaggagatggcctgactgcgaaggcgagtgagaagccgcctgaacggaagagaagcgagcgcgttaggagagcagaacctccaaaacctgaggttgtagattccactgagagcattccagtgtcagatgaggattctgatgccatggtagatgaccccaatgatgaggactttgtgccattccggccccggcgctctcctcgcatgtccctacgctcaagtgtgtcacaaagggccgggcgctctgcagtgggcaccaagatgacttgtgcacattgccggacaccactgcagaaggggcagactgcctatcagcgcaaggggctgcctcagctcttctgctcgtcatcctgcctcaccactttctccaagaagccctcgggcaaaaagacctgtaccttctgcaagaaggagatctggaacaccaaggactcggttgtggcgcagactggttctggaggctccttccatgagttctgcacatccgtctgtctctccctgtatgaggcccagcagcagcgcccgatcccccagtctggggatcccgccgacgctactcgctgcagcatatgccagaagactggagaggtcctgcacgaggtcagcaatggcagcgtggtacaccggctctgcagcgattcttgcttctccaaattccgggccaacaagggactgaaaaccaactgttgtgaccagtgtggggcttacatctacaccaagaccgggagtcctggccctgagctcctcttccacgagggccaacaaaagcggttctgcaacacaacctgcttgggggcgtacaagaaggtggggccgagggagtag
Sequence Length
1488
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,485 Da
NCBI Official Full Name
Homo sapiens zinc finger, MYM-type 3, mRNA
NCBI Official Synonym Full Names
zinc finger MYM-type containing 3
NCBI Official Symbol
ZMYM3
NCBI Official Synonym Symbols
MYM; XFIM; ZNF261; DXS6673E; ZNF198L2
NCBI Protein Information
zinc finger MYM-type protein 3
UniProt Protein Name
Zinc finger MYM-type protein 3
UniProt Gene Name
ZMYM3
UniProt Synonym Gene Names
DXS6673E; KIAA0385; ZNF261
UniProt Entry Name
ZMYM3_HUMAN

NCBI Description

This gene is located on the X chromosome and is subject to X inactivation. It is highly conserved in vertebrates and most abundantly expressed in the brain. The encoded protein is a component of histone deacetylase-containing multiprotein complexes that function through modifying chromatin structure to keep genes silent. A chromosomal translocation (X;13) involving this gene is associated with X-linked mental retardation. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2010]

Uniprot Description

ZNF261: Plays a role in the regulation of cell morphology and cytoskeletal organization. A chromosomal aberration involving ZMYM3 may be a cause of X-linked mental retardation in Xq13.1. Translocation t(X;13)(q13.1;?). 3 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding

Chromosomal Location of Human Ortholog: Xq13.1

Cellular Component: cytoplasm; nucleoplasm

Molecular Function: DNA binding

Biological Process: cytoskeleton organization and biogenesis; multicellular organismal development; regulation of cell morphogenesis

Similar Products

Product Notes

The ZMYM3 zmym3 (Catalog #AAA1266543) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacccca gtgatttccc cagtccattt gacccattga ccctgccaga gaagcccctg gctggagacc taccagtaga catggaattt ggagaggatc tactggaatc ccagactgcc ccaactcgag gatgggcccc ccctggccct tctccatcct cgggagccct ggacctgctt gatacccctg ctggcctgga aaaagaccct ggagtcctgg atggagccac tgagttgctg gggctggggg ggctgctcta taaagccccc tctcccccgg aggtggacca cggtcctgag ggaaccctgg catgggatgc aggagatcag accctagagc ctggaccagg gggccagacc cctgaggtgg taccacctga tccaggggct ggggcaaatt cctgttcacc tgaggggcta ctagagcctt tggctccaga ttctccaata acactgcagt ccccacatat tgaagaggag gagaccacct ccatagctac tgcaagaagg ggctcccctg ggcaggagga ggagcttccc caagggcagc cacagagccc aaatgccccg cctagccctt cagtgggaga gactctgggg gatggaatca acagttctca gaccaaacct gggggctcta gcccccctgc acatccttcc ttgccaggag atggcctgac tgcgaaggcg agtgagaagc cgcctgaacg gaagagaagc gagcgcgtta ggagagcaga acctccaaaa cctgaggttg tagattccac tgagagcatt ccagtgtcag atgaggattc tgatgccatg gtagatgacc ccaatgatga ggactttgtg ccattccggc cccggcgctc tcctcgcatg tccctacgct caagtgtgtc acaaagggcc gggcgctctg cagtgggcac caagatgact tgtgcacatt gccggacacc actgcagaag gggcagactg cctatcagcg caaggggctg cctcagctct tctgctcgtc atcctgcctc accactttct ccaagaagcc ctcgggcaaa aagacctgta ccttctgcaa gaaggagatc tggaacacca aggactcggt tgtggcgcag actggttctg gaggctcctt ccatgagttc tgcacatccg tctgtctctc cctgtatgag gcccagcagc agcgcccgat cccccagtct ggggatcccg ccgacgctac tcgctgcagc atatgccaga agactggaga ggtcctgcac gaggtcagca atggcagcgt ggtacaccgg ctctgcagcg attcttgctt ctccaaattc cgggccaaca agggactgaa aaccaactgt tgtgaccagt gtggggctta catctacacc aagaccggga gtcctggccc tgagctcctc ttccacgagg gccaacaaaa gcggttctgc aacacaacct gcttgggggc gtacaagaag gtggggccga gggagtag. It is sometimes possible for the material contained within the vial of "ZMYM3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.