Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZIC4 cdna clone

ZIC4 cDNA Clone

Synonyms
ZIC4; ZIC4 cDNA Clone; ZIC4 cdna clone
Ordering
For Research Use Only!
Sequence
atgagatacaagacatccttggtgatgaggaaacgattacggctttaccgaaacactcttaaagagtcaagtagcagctctggacaccatggcccccagctcaccgccgcctccagcccctcggtgttcccgggcctccacgaggagcctccccaggcctcccccagccgtcctttgaatggactcctgcgtctggggctccctggagacatgtacgcgcggccggagcccttcccgccagggcctgcggcccgcagcgacgccctggcagctgccgcagccctgcatggctacgggggcatgaacctgacggtgaacctcgctgcgccccacggtcctggcgctttcttccgctacatgcgccagcccatcaaacaggagctcatctgcaagtggctggcggccgacggcaccgcgaccccgagcctctgctccaaaactttcagcaccatgcacgagctggtcacgcacgtcaccgtggagcacgtcggcggcccggaacaggccaaccacatttgcttctgggaggagtgtccgcgccagggaaagcccttcaaagccaaatacaaacttgtaaatcacatccgcgtgcacacgggcgagaagcccttcccttgtcctttcccggggtgtgggaaggtctttgctagatcagaaaatctcaaaatacacaaacgaactcacacaggcgagaagcccttcagatgcgagttcgagggctgcgagcggcgcttcgccaacagcagcgaccgtaagaagcattcgcacgtgcacactagcgacaagccatacacgtgcaaggtgcggggctgcgacaagtgctacacgcaccccagctcgctgcgtaagcacatgaaggtgcacgggcgctcgccgccgcccagctctggctacgattcggctacaccgtctgccctcgtgtcgccctcgtcggactgcggccacaagtcccaggtggcctcctcggcggcggtggcggcgcgtaccgccgacttgagcgaatga
Sequence Length
1005
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,641 Da
NCBI Official Full Name
Homo sapiens Zic family member 4, mRNA
NCBI Official Synonym Full Names
Zic family member 4
NCBI Official Symbol
ZIC4
NCBI Protein Information
zinc finger protein ZIC 4
UniProt Protein Name
Zinc finger protein ZIC 4
Protein Family
UniProt Gene Name
ZIC4
UniProt Entry Name
ZIC4_HUMAN

NCBI Description

This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. Members of this family are important during development, and have been associated with X-linked visceral heterotaxy and holoprosencephaly type 5. This gene is closely linked to the gene encoding zinc finger protein of the cerebellum 1, a related family member on chromosome 3. Heterozygous deletion of these linked genes is involved in Dandy-Walker malformation, which is a congenital cerebellar malformation. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Dec 2009]

Uniprot Description

ZIC4: Binds to DNA. Belongs to the GLI C2H2-type zinc-finger protein family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 3q24

Cellular Component: nucleus

Molecular Function: DNA binding

Research Articles on ZIC4

Similar Products

Product Notes

The ZIC4 zic4 (Catalog #AAA1277177) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagataca agacatcctt ggtgatgagg aaacgattac ggctttaccg aaacactctt aaagagtcaa gtagcagctc tggacaccat ggcccccagc tcaccgccgc ctccagcccc tcggtgttcc cgggcctcca cgaggagcct ccccaggcct cccccagccg tcctttgaat ggactcctgc gtctggggct ccctggagac atgtacgcgc ggccggagcc cttcccgcca gggcctgcgg cccgcagcga cgccctggca gctgccgcag ccctgcatgg ctacgggggc atgaacctga cggtgaacct cgctgcgccc cacggtcctg gcgctttctt ccgctacatg cgccagccca tcaaacagga gctcatctgc aagtggctgg cggccgacgg caccgcgacc ccgagcctct gctccaaaac tttcagcacc atgcacgagc tggtcacgca cgtcaccgtg gagcacgtcg gcggcccgga acaggccaac cacatttgct tctgggagga gtgtccgcgc cagggaaagc ccttcaaagc caaatacaaa cttgtaaatc acatccgcgt gcacacgggc gagaagccct tcccttgtcc tttcccgggg tgtgggaagg tctttgctag atcagaaaat ctcaaaatac acaaacgaac tcacacaggc gagaagccct tcagatgcga gttcgagggc tgcgagcggc gcttcgccaa cagcagcgac cgtaagaagc attcgcacgt gcacactagc gacaagccat acacgtgcaa ggtgcggggc tgcgacaagt gctacacgca ccccagctcg ctgcgtaagc acatgaaggt gcacgggcgc tcgccgccgc ccagctctgg ctacgattcg gctacaccgt ctgccctcgt gtcgccctcg tcggactgcg gccacaagtc ccaggtggcc tcctcggcgg cggtggcggc gcgtaccgcc gacttgagcg aatga. It is sometimes possible for the material contained within the vial of "ZIC4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.