Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZDHHC3 cdna clone

ZDHHC3 cDNA Clone

Gene Names
ZDHHC3; GODZ; DHHC-3; ZNF373
Synonyms
ZDHHC3; ZDHHC3 cDNA Clone; ZDHHC3 cdna clone
Ordering
For Research Use Only!
Sequence
atgatgcttatccccacccaccacttccgaaacattgagcggaaaccagaatacctccagccagagaagtgtgtcccacccccctaccctggtcctgtgggaaccatgtggtttatccgtgacggctgtggcatcgcctgtgccatcgttacctggtttctggtcctctatgcggagttcgtggtcctctttgtcatgctgattccatctcgagactacgtgtatagcatcatcaacggaattgtgttcaacctgctggccttcttggccctggcctcccactgccgggccatgctgacggaccccggggcagtgcccaaaggaaatgccactaaagaattcatcgagagtttacagttgaagcctgggcaggtggtgtacaagtgccccaaatgctgcagcatcaagcccgaccgagcccaccactgcagtgtttgtaagcggtgcattcggaagatggaccaccactgtccctgggtcaacaactgtgtaggcgagaacaaccagaagtacttcgtcctgtttacaatgtacatagctctcatttccttgcacgccctcatcatggtgggattccacttcctgcattgctttgaagaagattggacaaagtgcagctccttctctccacccaccacagtgattctccttatcctgctgtgctttgagggcctgctcttcctcattttcacatcagtgatgtttgggacccaggtgcactccatctgcacagatgagacgggaatagaacaattgaaaaaggaagagagaagatgggctaaaaaaacaaaatggatgaacatgaaagccgtttttggccaccccttctctctaggctgggccagcccctttgccacgccagaccaagggaaggcagacccgtaccagtatgtggtctga
Sequence Length
900
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,338 Da
NCBI Official Full Name
Homo sapiens zinc finger, DHHC-type containing 3, mRNA
NCBI Official Synonym Full Names
zinc finger DHHC-type containing 3
NCBI Official Symbol
ZDHHC3
NCBI Official Synonym Symbols
GODZ; DHHC-3; ZNF373
NCBI Protein Information
palmitoyltransferase ZDHHC3
UniProt Protein Name
Palmitoyltransferase ZDHHC3
Protein Family
UniProt Gene Name
ZDHHC3
UniProt Synonym Gene Names
DHHC-3
UniProt Entry Name
ZDHC3_HUMAN

Uniprot Description

ZDHHC3: Palmitoyltransferase with broad specificity. Palmitoylates GABA receptors on their gamma subunit (GABRG1, GABRG2 and GABRG3), which regulates synaptic clustering and/or cell surface stability. Palmitoylates glutamate receptors GRIA1 and GRIA2, which leads to their retention in Golgi. Belongs to the DHHC palmitoyltransferase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 2.3.1.225; Membrane protein, integral; Transferase; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 3p21.31

Cellular Component: Golgi apparatus; membrane

Molecular Function: palmitoyltransferase activity

Biological Process: protein palmitoylation

Research Articles on ZDHHC3

Similar Products

Product Notes

The ZDHHC3 zdhhc3 (Catalog #AAA1272343) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgctta tccccaccca ccacttccga aacattgagc ggaaaccaga atacctccag ccagagaagt gtgtcccacc cccctaccct ggtcctgtgg gaaccatgtg gtttatccgt gacggctgtg gcatcgcctg tgccatcgtt acctggtttc tggtcctcta tgcggagttc gtggtcctct ttgtcatgct gattccatct cgagactacg tgtatagcat catcaacgga attgtgttca acctgctggc cttcttggcc ctggcctccc actgccgggc catgctgacg gaccccgggg cagtgcccaa aggaaatgcc actaaagaat tcatcgagag tttacagttg aagcctgggc aggtggtgta caagtgcccc aaatgctgca gcatcaagcc cgaccgagcc caccactgca gtgtttgtaa gcggtgcatt cggaagatgg accaccactg tccctgggtc aacaactgtg taggcgagaa caaccagaag tacttcgtcc tgtttacaat gtacatagct ctcatttcct tgcacgccct catcatggtg ggattccact tcctgcattg ctttgaagaa gattggacaa agtgcagctc cttctctcca cccaccacag tgattctcct tatcctgctg tgctttgagg gcctgctctt cctcattttc acatcagtga tgtttgggac ccaggtgcac tccatctgca cagatgagac gggaatagaa caattgaaaa aggaagagag aagatgggct aaaaaaacaa aatggatgaa catgaaagcc gtttttggcc accccttctc tctaggctgg gccagcccct ttgccacgcc agaccaaggg aaggcagacc cgtaccagta tgtggtctga. It is sometimes possible for the material contained within the vial of "ZDHHC3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.