ZDHHC19 cdna clone
ZDHHC19 cDNA Clone
Gene Names
ZDHHC19; DHHC19
Synonyms
ZDHHC19; ZDHHC19 cDNA Clone; ZDHHC19 cdna clone
Sequence
atgacactcttaacggatgccacgccgctggtgaaggagccccatcccctgcctctggtcccacgtccctggttcctccctagcctctttgctgccttcaatgtggtgctgctggtctttttcagtggcctcttcttcgcattcccttgcaggtggctggctcagaacggggagtgggcctttcctgttatcacaggctccctctttgtccttaccttcttcagtcttgtttcactcaacttctcagaccctggcatcttacatcaaggctccgctgagcagggccccttgacggtgcacgtggtgtgggtgaaccacggggccttccgcctgcaatggtgtccaaagtgctgcttccaccgcccgccccggacttaccactgcccctggtgcaacatctgtgtggaggactttgaccaccactgcaagtgggtcaataactgcatcggtcaccgcaacttccgcttcttcatgctgcttgtcctgtccctgtgcctctactcgggcgccatgctggtcacctgtctcatcttcctggtgcgcacaacccacctgcccttctccaccgacaaggccatcgccatcgtggtggccgtgtccgccgcgggcctcctggtgccgctgtccctcctgctgctgatccaggcactgtccgtgagctcggccgaccgcacctacaagggcaagtgcagacaccttcagggatacaaccccttcgaccagggctgtgccagcaactggtatttaacaatttgtgcaccactgggacccaaggctgctgcatcctggatgaggctggcctcagcttcctgcagagctaagccctgggccgtgtgcttcccaagctga
Sequence Length
849
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
25,718 Da
NCBI Official Full Name
Homo sapiens zinc finger, DHHC-type containing 19, mRNA
NCBI Official Synonym Full Names
zinc finger DHHC-type containing 19
NCBI Official Symbol
ZDHHC19
NCBI Official Synonym Symbols
DHHC19
NCBI Protein Information
probable palmitoyltransferase ZDHHC19
UniProt Protein Name
Probable palmitoyltransferase ZDHHC19
Protein Family
UniProt Gene Name
ZDHHC19
UniProt Synonym Gene Names
DHHC-19
UniProt Entry Name
ZDH19_HUMAN
Uniprot Description
ZDHHC19: Belongs to the DHHC palmitoyltransferase family.
Protein type: EC 2.3.1.225; Membrane protein, integral; Transferase; Palmitoyltransferase; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 3q29
Cellular Component: endoplasmic reticulum
Research Articles on ZDHHC19
Similar Products
Product Notes
The ZDHHC19 zdhhc19 (Catalog #AAA1276684) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacactct taacggatgc cacgccgctg gtgaaggagc cccatcccct gcctctggtc ccacgtccct ggttcctccc tagcctcttt gctgccttca atgtggtgct gctggtcttt ttcagtggcc tcttcttcgc attcccttgc aggtggctgg ctcagaacgg ggagtgggcc tttcctgtta tcacaggctc cctctttgtc cttaccttct tcagtcttgt ttcactcaac ttctcagacc ctggcatctt acatcaaggc tccgctgagc agggcccctt gacggtgcac gtggtgtggg tgaaccacgg ggccttccgc ctgcaatggt gtccaaagtg ctgcttccac cgcccgcccc ggacttacca ctgcccctgg tgcaacatct gtgtggagga ctttgaccac cactgcaagt gggtcaataa ctgcatcggt caccgcaact tccgcttctt catgctgctt gtcctgtccc tgtgcctcta ctcgggcgcc atgctggtca cctgtctcat cttcctggtg cgcacaaccc acctgccctt ctccaccgac aaggccatcg ccatcgtggt ggccgtgtcc gccgcgggcc tcctggtgcc gctgtccctc ctgctgctga tccaggcact gtccgtgagc tcggccgacc gcacctacaa gggcaagtgc agacaccttc agggatacaa ccccttcgac cagggctgtg ccagcaactg gtatttaaca atttgtgcac cactgggacc caaggctgct gcatcctgga tgaggctggc ctcagcttcc tgcagagcta agccctgggc cgtgtgcttc ccaagctga. It is sometimes possible for the material contained within the vial of "ZDHHC19, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
