ZDHHC11 cdna clone
ZDHHC11 cDNA Clone
Gene Names
ZDHHC11; ZNF399
Synonyms
ZDHHC11; ZDHHC11 cDNA Clone; ZDHHC11 cdna clone
Sequence
atggacacccgctccgggagccagtgttccgtcaccccagaagccatactcaataatgaaaagctggtcttgccgccccgcatctccagagtgaacggctggtcgttacccctgcactacttccaggtggtgacctgggctgtcttcgtgggcctttcctcggccaccttcgggatcttcattcccttcctgcctcacgcgtggaaatacattgcctacgtggtgaccggggggatcttctcgttccacctcgtcgtccacctgatcgcgtcctgcatcgacccggccgactccaatgtcagactcatgaagaactattctcagcccatgcccctcttcgacagatcaaaacatgcacacgtgatccagaatcagttctgccacctgtgcaaggtcaccgtgaacaagaaaaccaaacactgcatttcctgcaataagtgtgtgtccggcttcgaccaccactgcaaatggatcaacaactgcgtgggaagccggaattattggttcttcttcagcactgtggcctcggccacagctggcatgctctgcctgatcgccatcctgctgtatgtcctcgtccagtacctcgtgaaccccggggtgctccgcacggaccccaggtatgaagatgtcaagaatatgaacacgtggctgctgttcctccccctgttcccggtgcaggtgcagaccctgatagtcgtgatcatcgggatgctcgtgctcctgctggactttcttggcttggtgcacctgggccagctgctcatcttccacatctacctgaaggccaagaagatgaccacctttgagtatctcattaataaccgcaaagaagagagttcaaaacatcaagcagtgaggaaagatccatacgtgcaaatggacaaaggagttctccagcaaggagctggcgccctgggctcatctgcacagggagtcaaagccaagagctccctgctgattcacaagcacttatgtcacttctgcacttcagtaaaccaggatggggattcgacggcacgggaaggggatgaagacccgtgtccatctgcacttggagccaaggccaggaactcccggctgatttgcaggcgcctgtgtcagttctccactcgtgtacacccagacgggggctcgatggcacaggaagcagatgatgccccgagtatatctacacttgggctgcaacaagaaacaacagagcccatgaaaactgacagtgctgaaagtgaagactga
Sequence Length
1239
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
15,690 Da
NCBI Official Full Name
Homo sapiens zinc finger, DHHC-type containing 11, mRNA
NCBI Official Synonym Full Names
zinc finger DHHC-type containing 11
NCBI Official Symbol
ZDHHC11
NCBI Official Synonym Symbols
ZNF399
NCBI Protein Information
probable palmitoyltransferase ZDHHC11
UniProt Protein Name
Probable palmitoyltransferase ZDHHC11
Protein Family
UniProt Gene Name
ZDHHC11
UniProt Synonym Gene Names
ZNF399; DHHC-11
UniProt Entry Name
ZDH11_HUMAN
Uniprot Description
ZDHHC11: Belongs to the DHHC palmitoyltransferase family.
Protein type: Transferase; Membrane protein, integral; EC 2.3.1.225; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 5p15.33
Cellular Component: endoplasmic reticulum
Research Articles on ZDHHC11
Similar Products
Product Notes
The ZDHHC11 zdhhc11 (Catalog #AAA1271123) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacaccc gctccgggag ccagtgttcc gtcaccccag aagccatact caataatgaa aagctggtct tgccgccccg catctccaga gtgaacggct ggtcgttacc cctgcactac ttccaggtgg tgacctgggc tgtcttcgtg ggcctttcct cggccacctt cgggatcttc attcccttcc tgcctcacgc gtggaaatac attgcctacg tggtgaccgg ggggatcttc tcgttccacc tcgtcgtcca cctgatcgcg tcctgcatcg acccggccga ctccaatgtc agactcatga agaactattc tcagcccatg cccctcttcg acagatcaaa acatgcacac gtgatccaga atcagttctg ccacctgtgc aaggtcaccg tgaacaagaa aaccaaacac tgcatttcct gcaataagtg tgtgtccggc ttcgaccacc actgcaaatg gatcaacaac tgcgtgggaa gccggaatta ttggttcttc ttcagcactg tggcctcggc cacagctggc atgctctgcc tgatcgccat cctgctgtat gtcctcgtcc agtacctcgt gaaccccggg gtgctccgca cggaccccag gtatgaagat gtcaagaata tgaacacgtg gctgctgttc ctccccctgt tcccggtgca ggtgcagacc ctgatagtcg tgatcatcgg gatgctcgtg ctcctgctgg actttcttgg cttggtgcac ctgggccagc tgctcatctt ccacatctac ctgaaggcca agaagatgac cacctttgag tatctcatta ataaccgcaa agaagagagt tcaaaacatc aagcagtgag gaaagatcca tacgtgcaaa tggacaaagg agttctccag caaggagctg gcgccctggg ctcatctgca cagggagtca aagccaagag ctccctgctg attcacaagc acttatgtca cttctgcact tcagtaaacc aggatgggga ttcgacggca cgggaagggg atgaagaccc gtgtccatct gcacttggag ccaaggccag gaactcccgg ctgatttgca ggcgcctgtg tcagttctcc actcgtgtac acccagacgg gggctcgatg gcacaggaag cagatgatgc cccgagtata tctacacttg ggctgcaaca agaaacaaca gagcccatga aaactgacag tgctgaaagt gaagactga. It is sometimes possible for the material contained within the vial of "ZDHHC11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
