Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZCCHC17 cdna clone

ZCCHC17 cDNA Clone

Gene Names
ZCCHC17; PS1D; pNO40; HSPC251
Synonyms
ZCCHC17; ZCCHC17 cDNA Clone; ZCCHC17 cdna clone
Ordering
For Research Use Only!
Sequence
atgaattcaggaaggcctgagaccatggaaaacttgcctgctctctacactattttccaaggagaggttgctatggtgacagactatggggcctttatcaaaatcccaggctgtcggaagcaaggtctggtccatcgaactcatatgtcatcctgtcgggtggataagccctctgagatagtagatgttggagataaagtgtgggtgaagcttattggccgagagatgaaaaatgatagaataaaagtatccctctccatgaaggttgtcaatcaagggactgggaaagaccttgatcccaacaatgttatcattgagcaagaagagaggcggaggcgatccttccaggattacactgggcagaagatcacccttgaggctgtcttgaacactacctgcaagaagtgtggctgtaaaggccactttgcaaaagattgtttcatgcaaccaggtgggactaaatactctctgatacctgatgaggaagaggaaaaggaagaggcaaagtcagcagagtttgagaagcctgaccctacaaggaatccttctagaaaaagaaagaaggagaagaagaaaaagaaacatagagataggaagtcatctgactctgacagctcagactctgagagtgatacaggcaagagggcaaggcacacatcaaaagacagcaaggcagcaaagaagaagaaaaagaagaagaagcacaagaagaagcacaaggagtga
Sequence Length
726
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,810 Da
NCBI Official Full Name
Homo sapiens zinc finger, CCHC domain containing 17, mRNA
NCBI Official Synonym Full Names
zinc finger CCHC-type containing 17
NCBI Official Symbol
ZCCHC17
NCBI Official Synonym Symbols
PS1D; pNO40; HSPC251
NCBI Protein Information
nucleolar protein of 40 kDa
UniProt Protein Name
Nucleolar protein of 40 kDa
Protein Family
UniProt Gene Name
ZCCHC17
UniProt Synonym Gene Names
PS1D; pNO40; PS1D protein
UniProt Entry Name
NO40_HUMAN

Uniprot Description

ZCCHC17: 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Nucleolus; RNA-binding; Ribosomal

Chromosomal Location of Human Ortholog: 1p35.2

Cellular Component: intermediate filament cytoskeleton; intracellular membrane-bound organelle; nucleus

Molecular Function: protein binding

Biological Process: positive regulation of defense response to virus by host

Research Articles on ZCCHC17

Similar Products

Product Notes

The ZCCHC17 zcchc17 (Catalog #AAA1270035) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaattcag gaaggcctga gaccatggaa aacttgcctg ctctctacac tattttccaa ggagaggttg ctatggtgac agactatggg gcctttatca aaatcccagg ctgtcggaag caaggtctgg tccatcgaac tcatatgtca tcctgtcggg tggataagcc ctctgagata gtagatgttg gagataaagt gtgggtgaag cttattggcc gagagatgaa aaatgataga ataaaagtat ccctctccat gaaggttgtc aatcaaggga ctgggaaaga ccttgatccc aacaatgtta tcattgagca agaagagagg cggaggcgat ccttccagga ttacactggg cagaagatca cccttgaggc tgtcttgaac actacctgca agaagtgtgg ctgtaaaggc cactttgcaa aagattgttt catgcaacca ggtgggacta aatactctct gatacctgat gaggaagagg aaaaggaaga ggcaaagtca gcagagtttg agaagcctga ccctacaagg aatccttcta gaaaaagaaa gaaggagaag aagaaaaaga aacatagaga taggaagtca tctgactctg acagctcaga ctctgagagt gatacaggca agagggcaag gcacacatca aaagacagca aggcagcaaa gaagaagaaa aagaagaaga agcacaagaa gaagcacaag gagtga. It is sometimes possible for the material contained within the vial of "ZCCHC17, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.