ZC3H3 cdna clone
ZC3H3 cDNA Clone
Gene Names
ZC3H3; ZC3HDC3
Synonyms
ZC3H3; ZC3H3 cDNA Clone; ZC3H3 cdna clone
Sequence
atggagccaggaggagagcccacaggtgctaaagagagcagtaccctgatggagtcccttgcaggccggctggatcctgcaggcagctgtagccgttccctggccagccgggcagtgcagcgcagcctggccatcatccggcaggcgcggcagcgcagggagaagaggaaggagtactgcatgtactacaaccgcttcggcaggtgcaaccgtggcgagcgctgcccctacatccacgatcccgagaaggtggccgtgtgcaccaggtttgtccggggcacctgcaagaaaacggatgggacctgccccttctcccaccatgtgtccaaggagaagatgccggtgtgctcctacttcctgaagggcatctgcagcaacagcaactgtccctatagccacgtgtacgtgtcccgcaaggccgaggtctgcagcgacttcctcaaaggctactgccccctgggtgcaaagtgcaagaagaaacacacgctgctgtgccccgactttgcccgcaggggggcgtgtccccgcggcgcccagtgccagctgctccaccgtacccagaaacgccacagtcggcgggcagccacgtcccccgccccagggcccagcgacgcaaccgccaggagcagggtctcggccagccacgggcccaggaagccttcagcatcccagcgccccaccaggcagacgcccagctcggctgccctcactgcggctgccgtggctgcacctccccactgcccaggggggtcagcctctccctcatcctcgaaggcttcctcctcctcctcctcctcctcatcccctcccgcttccttggaccacgaggcaccatctctccaggaggctgccttagcagcagcgtgctccaacaggctctgcaagctgccttccttcatctccctgcagtcctcgccgagcccaggagcccagcccagggtccgggcccctagggcccccctcaccaaggactcagggaagcctctgcacatcaaaccacgtctgtga
Sequence Length
1008
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
35,929 Da
NCBI Official Full Name
Homo sapiens zinc finger CCCH-type containing 3, mRNA
NCBI Official Synonym Full Names
zinc finger CCCH-type containing 3
NCBI Official Symbol
ZC3H3
NCBI Official Synonym Symbols
ZC3HDC3
NCBI Protein Information
zinc finger CCCH domain-containing protein 3
UniProt Protein Name
Zinc finger CCCH domain-containing protein 3
UniProt Gene Name
ZC3H3
UniProt Entry Name
ZC3H3_HUMAN
Uniprot Description
ZC3H3: 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 8q24.3
Cellular Component: nucleus
Biological Process: mRNA polyadenylation; poly(A)+ mRNA export from nucleus
Research Articles on ZC3H3
Similar Products
Product Notes
The ZC3H3 zc3h3 (Catalog #AAA1274196) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagccag gaggagagcc cacaggtgct aaagagagca gtaccctgat ggagtccctt gcaggccggc tggatcctgc aggcagctgt agccgttccc tggccagccg ggcagtgcag cgcagcctgg ccatcatccg gcaggcgcgg cagcgcaggg agaagaggaa ggagtactgc atgtactaca accgcttcgg caggtgcaac cgtggcgagc gctgccccta catccacgat cccgagaagg tggccgtgtg caccaggttt gtccggggca cctgcaagaa aacggatggg acctgcccct tctcccacca tgtgtccaag gagaagatgc cggtgtgctc ctacttcctg aagggcatct gcagcaacag caactgtccc tatagccacg tgtacgtgtc ccgcaaggcc gaggtctgca gcgacttcct caaaggctac tgccccctgg gtgcaaagtg caagaagaaa cacacgctgc tgtgccccga ctttgcccgc aggggggcgt gtccccgcgg cgcccagtgc cagctgctcc accgtaccca gaaacgccac agtcggcggg cagccacgtc ccccgcccca gggcccagcg acgcaaccgc caggagcagg gtctcggcca gccacgggcc caggaagcct tcagcatccc agcgccccac caggcagacg cccagctcgg ctgccctcac tgcggctgcc gtggctgcac ctccccactg cccagggggg tcagcctctc cctcatcctc gaaggcttcc tcctcctcct cctcctcctc atcccctccc gcttccttgg accacgaggc accatctctc caggaggctg ccttagcagc agcgtgctcc aacaggctct gcaagctgcc ttccttcatc tccctgcagt cctcgccgag cccaggagcc cagcccaggg tccgggcccc tagggccccc ctcaccaagg actcagggaa gcctctgcac atcaaaccac gtctgtga. It is sometimes possible for the material contained within the vial of "ZC3H3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
