Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZBTB9 cdna clone

ZBTB9 cDNA Clone

Gene Names
ZBTB9; ZNF919
Synonyms
ZBTB9; ZBTB9 cDNA Clone; ZBTB9 cdna clone
Ordering
For Research Use Only!
Sequence
atggaaaccccaacacctttgccgcctgtacccgcctccccgacctgcaacccagccccacggacaatccagatcgagttcccacagcatagctcgtcgctgctggaatctctgaaccgccacaggctagagggaaagttctgtgatgtgtccctcctggtgcagggccgggaacttagggctcataaagcagtgttagctgctgcctctccttacttccatgacaagctgcttctgggggatgcgcctcgtctcactctaccgagtgtcattgaagccgatgccttcgaggggctgctccagctcatttattcagggcgtctccgcctgccactggatgctcttcctgctcatctccttgtggccagtggccttcaaatgtggcaggtagtagatcagtgctcagaaattcttagagaattagaaacttcaggtggtggaatttcagcccgtggaggaaactcctaccatgcccttctttccactacatcctctacaggaggctggtgcattcgctcttcgcctttccagaccccagtacagtcctctgcttctactgaaagccctgcttccactgagagccctgtgggaggggagggaagtgaactgggagaagtgctgcaaattcaggtggaagaagaagaggaggaggaggaagatgatgatgatgaggaccaggggtcagccacactctctcagactcctcagccccagagagtatcaggggtttttccccgtcctcatggaccccacccactgcccatgactgctactccccgaaagcttccagagggtgagagtgcaccacttgagcttcctgcccctcctgcactgccccccaaaatcttctacattaagcaggaacccttcgagcctaaggaggagatatcaggaagcggaactcagcctggaggagcaaaggaggaaaccaaagtgttttctggaggggacactgaagggaatggggagctagggttcttgttgccttcagggccagggccaacatctgggggagggggtccatcctggaaaccagtggatcttcatgggaatgaaatcctgtcagggggtggaggacctgggggagcaggccaggccgtgcatgggcctgtgaagctaggggggacaccccctgcagatggaaaacgctttggttgcctgtgtgggaagcggtttgcagtgaagccaaagcgtgaccggcacatcatgctgaccttcagccttcggccttttggctgtggcatctgcaacaagcgcttcaagctgaagcaccatctgacagagcacatgaagacccatgctggagccctgcatgcctgtccccactgtggccgtcggttccgagtccatgcctgttttctccgccaccgggacctatgcaagggccagggctgggccactgcccactggacttacaagtga
Sequence Length
1422
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
50,602 Da
NCBI Official Full Name
Homo sapiens zinc finger and BTB domain containing 9, mRNA
NCBI Official Synonym Full Names
zinc finger and BTB domain containing 9
NCBI Official Symbol
ZBTB9
NCBI Official Synonym Symbols
ZNF919
NCBI Protein Information
zinc finger and BTB domain-containing protein 9
UniProt Protein Name
Zinc finger and BTB domain-containing protein 9
UniProt Gene Name
ZBTB9
UniProt Entry Name
ZBTB9_HUMAN

Uniprot Description

ZBTB9: May be involved in transcriptional regulation.

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 6p21.32

Molecular Function: protein binding

Research Articles on ZBTB9

Similar Products

Product Notes

The ZBTB9 zbtb9 (Catalog #AAA1270291) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaaccc caacaccttt gccgcctgta cccgcctccc cgacctgcaa cccagcccca cggacaatcc agatcgagtt cccacagcat agctcgtcgc tgctggaatc tctgaaccgc cacaggctag agggaaagtt ctgtgatgtg tccctcctgg tgcagggccg ggaacttagg gctcataaag cagtgttagc tgctgcctct ccttacttcc atgacaagct gcttctgggg gatgcgcctc gtctcactct accgagtgtc attgaagccg atgccttcga ggggctgctc cagctcattt attcagggcg tctccgcctg ccactggatg ctcttcctgc tcatctcctt gtggccagtg gccttcaaat gtggcaggta gtagatcagt gctcagaaat tcttagagaa ttagaaactt caggtggtgg aatttcagcc cgtggaggaa actcctacca tgcccttctt tccactacat cctctacagg aggctggtgc attcgctctt cgcctttcca gaccccagta cagtcctctg cttctactga aagccctgct tccactgaga gccctgtggg aggggaggga agtgaactgg gagaagtgct gcaaattcag gtggaagaag aagaggagga ggaggaagat gatgatgatg aggaccaggg gtcagccaca ctctctcaga ctcctcagcc ccagagagta tcaggggttt ttccccgtcc tcatggaccc cacccactgc ccatgactgc tactccccga aagcttccag agggtgagag tgcaccactt gagcttcctg cccctcctgc actgcccccc aaaatcttct acattaagca ggaacccttc gagcctaagg aggagatatc aggaagcgga actcagcctg gaggagcaaa ggaggaaacc aaagtgtttt ctggagggga cactgaaggg aatggggagc tagggttctt gttgccttca gggccagggc caacatctgg gggagggggt ccatcctgga aaccagtgga tcttcatggg aatgaaatcc tgtcaggggg tggaggacct gggggagcag gccaggccgt gcatgggcct gtgaagctag gggggacacc ccctgcagat ggaaaacgct ttggttgcct gtgtgggaag cggtttgcag tgaagccaaa gcgtgaccgg cacatcatgc tgaccttcag ccttcggcct tttggctgtg gcatctgcaa caagcgcttc aagctgaagc accatctgac agagcacatg aagacccatg ctggagccct gcatgcctgt ccccactgtg gccgtcggtt ccgagtccat gcctgttttc tccgccaccg ggacctatgc aagggccagg gctgggccac tgcccactgg acttacaagt ga. It is sometimes possible for the material contained within the vial of "ZBTB9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.