Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZBTB7B cdna clone

ZBTB7B cDNA Clone

Gene Names
ZBTB7B; CKROX; THPOK; ZFP67; ZBTB15; ZFP-67; c-KROX; hcKROX; ZNF857B
Synonyms
ZBTB7B; ZBTB7B cDNA Clone; ZBTB7B cdna clone
Ordering
For Research Use Only!
Sequence
atggggagccccgaggatgacctgattgggattccattcccggaccacagcagtgagctcctgagctgcctcaatgagcagcgccagctgggccacctatgtgacctcaccatccggacgcagggccttgaataccgcacccacagggctgtgctagctgcctgtagccactacttcaagaagcttttcactgagggcggtggcggagctgtcatgggggccgggggtagcgggacggccactgggggagcaggggccggtgtgtgtgagctggactttgtagggccagaggcactaggcgccctccttgaatttgcctatacagccacactgaccaccagcagcgccaacatgccagctgtgctccaggctgcccgcctgctggagattccgtgtgtcatcgctgcttgcatggagattctgcagggcagtgggctagaagctcccagcccggacgaggatgactgtgagcgagcccgccagtatctggaggcctttgccacagccacggcctctggagttcccaatggtgaagacagtcctccacaggtgcccctcccaccacctccgccaccgccacctcggcctgttgcccgccgcagccgcaagccccggaaagctttcctgcaaaccaagggggccagagcaaaccacctagtccctgaggtgcccacagtgcccgcccatcccttgacctatgaggaggaggaggtggcgggcagagtgggcagcagtgggggcagtgggccgggggacagctacagccctcccacaggaactgcctcccctcctgagggtccccagagctacgaaccctatgagggtgaggaagaagaagaggagctggtatatcccccagcctatgggctggcgcagggtggcgggcccccgctgtccccagaggagctgggctcagatgaggatgccatcgatcctgacctgatggcctacctaagctccctgcaccaggacaacctggcaccaggcctggacagccaagacaagctggtgcgcaaacgccgctcccagatgcctcaggagtgccctgtctgccacaagatcatccatggggcaggcaaactgcctcgccacatgaggacccacacaggcgagaagccctttgcctgcgaggtctgcggtgttcgattcaccaggaacgacaagctgaagatccacatgcggaagcacacgggagagcgcccctactcatgcccgcactgcccagcccgcttcctgcacagctacgacctcaagaaccacatgcacctgcacacaggggaccggccctatgagtgccacctgtgccacaaggctttcgccaaggaggaccacctgcagcgccacctcaaaggccagaactgcctggaggtgcgcacccgacggcgccgcaaggacgatgcaccaccccactacccgccaccctctaccgctgctgcatcccccgctggcctcgacctctccaatggccacctggacaccttccgcctctctctagctcgattctgggagcagtcagcccccactgggcccccggtctctaccccagggccccctgatgacgatgaggaggaaggggcacccaccacaccccaggctgaaggtgccatggagtcctcttaa
Sequence Length
1620
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
61,584 Da
NCBI Official Full Name
Homo sapiens zinc finger and BTB domain containing 7B, mRNA
NCBI Official Synonym Full Names
zinc finger and BTB domain containing 7B
NCBI Official Symbol
ZBTB7B
NCBI Official Synonym Symbols
CKROX; THPOK; ZFP67; ZBTB15; ZFP-67; c-KROX; hcKROX; ZNF857B
NCBI Protein Information
zinc finger and BTB domain-containing protein 7B
UniProt Protein Name
Zinc finger and BTB domain-containing protein 7B
UniProt Gene Name
ZBTB7B
UniProt Synonym Gene Names
ZBTB15; ZFP67; ZNF857B; hcKrox; Zfp-67
UniProt Entry Name
ZBT7B_HUMAN

NCBI Description

This gene encodes a zinc finger-containing transcription factor that acts as a key regulator of lineage commitment of immature T-cell precursors. It is necessary and sufficient for commitment of CD4 lineage, while its absence causes CD8 commitment. It also functions as a transcriptional repressor of type I collagen genes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]

Uniprot Description

ZBTB7B: Transcription regulator that acts as a key regulator of lineage commitment of immature T-cell precursors. Necessary and sufficient for commitment of CD4 lineage, while its absence causes CD8 commitment. Development of immature T-cell precursors (thymocytes) to either the CD4 helper or CD8 killer T-cell lineages correlates precisely with their T-cell receptor specificity for major histocompatibility complex class II or class I molecules, respectively. Transcriptional repressor of the collagen COL1A1 and COL1A2 genes. May also function as a repressor of fibronectin and possibly other extracellular matrix genes.

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 1q21.3

Cellular Component: nucleoplasm; nucleus

Molecular Function: protein binding

Biological Process: ectoderm development; transcription from RNA polymerase II promoter

Research Articles on ZBTB7B

Similar Products

Product Notes

The ZBTB7B zbtb7b (Catalog #AAA1277475) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggagcc ccgaggatga cctgattggg attccattcc cggaccacag cagtgagctc ctgagctgcc tcaatgagca gcgccagctg ggccacctat gtgacctcac catccggacg cagggccttg aataccgcac ccacagggct gtgctagctg cctgtagcca ctacttcaag aagcttttca ctgagggcgg tggcggagct gtcatggggg ccgggggtag cgggacggcc actgggggag caggggccgg tgtgtgtgag ctggactttg tagggccaga ggcactaggc gccctccttg aatttgccta tacagccaca ctgaccacca gcagcgccaa catgccagct gtgctccagg ctgcccgcct gctggagatt ccgtgtgtca tcgctgcttg catggagatt ctgcagggca gtgggctaga agctcccagc ccggacgagg atgactgtga gcgagcccgc cagtatctgg aggcctttgc cacagccacg gcctctggag ttcccaatgg tgaagacagt cctccacagg tgcccctccc accacctccg ccaccgccac ctcggcctgt tgcccgccgc agccgcaagc cccggaaagc tttcctgcaa accaaggggg ccagagcaaa ccacctagtc cctgaggtgc ccacagtgcc cgcccatccc ttgacctatg aggaggagga ggtggcgggc agagtgggca gcagtggggg cagtgggccg ggggacagct acagccctcc cacaggaact gcctcccctc ctgagggtcc ccagagctac gaaccctatg agggtgagga agaagaagag gagctggtat atcccccagc ctatgggctg gcgcagggtg gcgggccccc gctgtcccca gaggagctgg gctcagatga ggatgccatc gatcctgacc tgatggccta cctaagctcc ctgcaccagg acaacctggc accaggcctg gacagccaag acaagctggt gcgcaaacgc cgctcccaga tgcctcagga gtgccctgtc tgccacaaga tcatccatgg ggcaggcaaa ctgcctcgcc acatgaggac ccacacaggc gagaagccct ttgcctgcga ggtctgcggt gttcgattca ccaggaacga caagctgaag atccacatgc ggaagcacac gggagagcgc ccctactcat gcccgcactg cccagcccgc ttcctgcaca gctacgacct caagaaccac atgcacctgc acacagggga ccggccctat gagtgccacc tgtgccacaa ggctttcgcc aaggaggacc acctgcagcg ccacctcaaa ggccagaact gcctggaggt gcgcacccga cggcgccgca aggacgatgc accaccccac tacccgccac cctctaccgc tgctgcatcc cccgctggcc tcgacctctc caatggccac ctggacacct tccgcctctc tctagctcga ttctgggagc agtcagcccc cactgggccc ccggtctcta ccccagggcc ccctgatgac gatgaggagg aaggggcacc caccacaccc caggctgaag gtgccatgga gtcctcttaa. It is sometimes possible for the material contained within the vial of "ZBTB7B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.