ZBTB7A cdna clone
ZBTB7A cDNA Clone
Gene Names
ZBTB7A; LRF; FBI1; FBI-1; TIP21; ZBTB7; ZNF857A; pokemon
Synonyms
ZBTB7A; ZBTB7A cDNA Clone; ZBTB7A cdna clone
Sequence
atggccggcggcgtggacggccccatcgggatcccgttccccgaccacagcagcgacatcctgagtgggctgaacgagcagcggacgcagggcctgctgtgcgacgtggtgatcctggtggagggccgcgagttccccacgcaccgctcggtgctggccgcctgcagccagtacttcaagaagctgttcacgtcgggcgccgtggtggaccagcagaacgtgtacgagatcgacttcgtcagcgccgaggcgctcaccgcgctcatggacttcgcctacacggccacgctcaccgtcagcacagccaacgtgggtgacatcctcagcgccgcccgcctgctggagatccccgccgtgagccacgtgtgcgccgacctcctggaccggcagatcctggcggccgacgcgggcgccgacgccgggcagctggaccttgtagatcaaattgatcagcgcaacctcctccgcgccaaggagtacctcgagttcttccagagcaaccccatgaacagcctgccccccgcggccgccgccgccgctgccagcttcccgtggtccgcctttggggcgtccgatgatgacctggatgccaccaaggaggccgtggccgccgctgtggccgccgtggccgcgggcgactgcaacggcttagacttctatgggccgggccccccggccgagcggcccccgacgggggacggggacgagggcgacagcaacccgggtctgtggccagagcgggatgaggacgcccccaccgggggtctctttccgccgccggtggccccgccggccgccacgcagaacggccactacggccgcggcggagaggaggaggccgcctcgctgtcggaggcggcccccgagccgggcgactctccgggcttcctgtcgggagcggccgagggcgaggacggggacgggcccgacgtggacgggctggcggccagcacgctgctgcagcagatgatgtcatcggtgggccgggcgggggccgcggcgggggacagcgacgaggagtcgcgggccgacgacaagggcgtcatggactactacctgaagtacttcagcggcgcccacgacggcgacgtctacccggcctggtcgcagaaggtggagaagaagatccgagccaaggccttccagaagtgccccatctgcgagaaggtcatccagggcgccggcaagctgccgcgacacatccgcacccacacgggcgagaagccctacgagtgcaacatctgcaaggtccgcttcaccaggcaggacaagctgaaggtgcacatgcggaagcacacgggcgagaagccgtacctgtgccagcagtgcggcgccgcctttgcccacaactacgacctgaagaaccacatgcgcgtgcacacgggcctgcgcccctaccagtgcgacagctgctgcaagaccttcgtccgctccgaccacctgcacagacacctcaagaaagacggctgcaacggcgtcccctcgcgccgcggccgcaagccccgcgtccggggcggggcgcccgaccccagcccgggggccactgcgacccccggcgcccccgcccagcccagctcccccgacgcccggcgcaacggccaggagaagcactttaaggacgaggacgaggacgaggacgtggccagccccgacggcttgggccggttgaatgtagcgggcgccggtggaggaggtgacagcggaggtggccccggggccgccaccgacggtaacttcacagccggactcgcctaa
Sequence Length
1755
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
61,439 Da
NCBI Official Full Name
Homo sapiens zinc finger and BTB domain containing 7A, mRNA
NCBI Official Synonym Full Names
zinc finger and BTB domain containing 7A
NCBI Official Symbol
ZBTB7A
NCBI Official Synonym Symbols
LRF; FBI1; FBI-1; TIP21; ZBTB7; ZNF857A; pokemon
NCBI Protein Information
zinc finger and BTB domain-containing protein 7A
UniProt Protein Name
Zinc finger and BTB domain-containing protein 7A
Protein Family
UniProt Gene Name
ZBTB7A
UniProt Synonym Gene Names
FBI1; LRF; ZBTB7; ZNF857A; FBI-1; POK erythroid myeloid ontogenic factor; Pokemon; TIP21
UniProt Entry Name
ZBT7A_HUMAN
Uniprot Description
FBI1: a widely expressed zinc finger protein. Apparently interacts with Bcl-6.
Protein type: DNA-binding; C2H2-type zinc finger protein; Transcription factor
Chromosomal Location of Human Ortholog: 19p13.3
Molecular Function: DNA binding; histone acetyltransferase binding; protein binding
Biological Process: negative regulation of transcription, DNA-dependent
Research Articles on ZBTB7A
Similar Products
Product Notes
The ZBTB7A zbtb7a (Catalog #AAA1271522) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccggcg gcgtggacgg ccccatcggg atcccgttcc ccgaccacag cagcgacatc ctgagtgggc tgaacgagca gcggacgcag ggcctgctgt gcgacgtggt gatcctggtg gagggccgcg agttccccac gcaccgctcg gtgctggccg cctgcagcca gtacttcaag aagctgttca cgtcgggcgc cgtggtggac cagcagaacg tgtacgagat cgacttcgtc agcgccgagg cgctcaccgc gctcatggac ttcgcctaca cggccacgct caccgtcagc acagccaacg tgggtgacat cctcagcgcc gcccgcctgc tggagatccc cgccgtgagc cacgtgtgcg ccgacctcct ggaccggcag atcctggcgg ccgacgcggg cgccgacgcc gggcagctgg accttgtaga tcaaattgat cagcgcaacc tcctccgcgc caaggagtac ctcgagttct tccagagcaa ccccatgaac agcctgcccc ccgcggccgc cgccgccgct gccagcttcc cgtggtccgc ctttggggcg tccgatgatg acctggatgc caccaaggag gccgtggccg ccgctgtggc cgccgtggcc gcgggcgact gcaacggctt agacttctat gggccgggcc ccccggccga gcggcccccg acgggggacg gggacgaggg cgacagcaac ccgggtctgt ggccagagcg ggatgaggac gcccccaccg ggggtctctt tccgccgccg gtggccccgc cggccgccac gcagaacggc cactacggcc gcggcggaga ggaggaggcc gcctcgctgt cggaggcggc ccccgagccg ggcgactctc cgggcttcct gtcgggagcg gccgagggcg aggacgggga cgggcccgac gtggacgggc tggcggccag cacgctgctg cagcagatga tgtcatcggt gggccgggcg ggggccgcgg cgggggacag cgacgaggag tcgcgggccg acgacaaggg cgtcatggac tactacctga agtacttcag cggcgcccac gacggcgacg tctacccggc ctggtcgcag aaggtggaga agaagatccg agccaaggcc ttccagaagt gccccatctg cgagaaggtc atccagggcg ccggcaagct gccgcgacac atccgcaccc acacgggcga gaagccctac gagtgcaaca tctgcaaggt ccgcttcacc aggcaggaca agctgaaggt gcacatgcgg aagcacacgg gcgagaagcc gtacctgtgc cagcagtgcg gcgccgcctt tgcccacaac tacgacctga agaaccacat gcgcgtgcac acgggcctgc gcccctacca gtgcgacagc tgctgcaaga ccttcgtccg ctccgaccac ctgcacagac acctcaagaa agacggctgc aacggcgtcc cctcgcgccg cggccgcaag ccccgcgtcc ggggcggggc gcccgacccc agcccggggg ccactgcgac ccccggcgcc cccgcccagc ccagctcccc cgacgcccgg cgcaacggcc aggagaagca ctttaaggac gaggacgagg acgaggacgt ggccagcccc gacggcttgg gccggttgaa tgtagcgggc gccggtggag gaggtgacag cggaggtggc cccggggccg ccaccgacgg taacttcaca gccggactcg cctaa. It is sometimes possible for the material contained within the vial of "ZBTB7A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
