Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZBTB37 cdna clone

ZBTB37 cDNA Clone

Gene Names
ZBTB37; ZNF908; D430004I08Rik
Synonyms
ZBTB37; ZBTB37 cDNA Clone; ZBTB37 cdna clone
Ordering
For Research Use Only!
Sequence
atggagaaaggtgggaacatacaattggagattcctgacttcagcaactctgtcctgagccatctaaaccagttgcgcatgcagggccgtctctgtgatattgtggtcaatgtgcaaggacaagcttttcgggctcacaaagtggtgctggctgccagctccccctatttccgggatcacatgtccttgaatgagatgagtacagtctccatttcagtcatcaagaaccctactgtttttgaacagctcctttctttctgttacacagggcggatatgcctgcaactggcagatatcatcagctacctaacagctgccagttttctgcaaatgcagcatattatagacaaatgtacacagatcctggagggcattcatttcaaaattaatgtggctgaggttgaagcagaattaagtcaaacaaggacaaagcatcaagagagacctccagagtctcacagggttacaccaaatctcaaccgctcccttagcccacgacataataccccaaagggaaaccggcgaggtcaggttagtgctgtgctggatatcagagagctaagtcctcctgaggagtccaccagccctcagatcattgaaccaagttctgatgtagagagccgggagcccattcttcggatcaaccgagcaggacagtggtatgtggagacaggagtggcggaccgtgggggtcggagtgatgatgaagttagagttcttggagcagtacacatcaaaactgaaaatctggaggagtggcttgggcctgagaatcagccttctggagaagatgggagtagtgcagaggaagtaacagccatggtgattgataccacaggccatggttctgtaggacaggaaaattatactttagggtcttcaggagccaaggtggctcggccaacaagcagtgaagttgacagatttagcccctccggcagtgttgttcccttgacagagagacacagagccagaagtgagtctcctgggagaatggatgagcctaagcaacccagctcccaggtatggagttgtggatttagaactgctttggtggttggaggaattgctactgtgtatgaatag
Sequence Length
1086
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,036 Da
NCBI Official Full Name
Homo sapiens zinc finger and BTB domain containing 37, mRNA
NCBI Official Synonym Full Names
zinc finger and BTB domain containing 37
NCBI Official Symbol
ZBTB37
NCBI Official Synonym Symbols
ZNF908; D430004I08Rik
NCBI Protein Information
zinc finger and BTB domain-containing protein 37
UniProt Protein Name
Zinc finger and BTB domain-containing protein 37
UniProt Gene Name
ZBTB37
UniProt Entry Name
ZBT37_HUMAN

Uniprot Description

ZBTB37: May be involved in transcriptional regulation. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: C2H2-type zinc finger protein; Transcription regulation; DNA-binding

Chromosomal Location of Human Ortholog: 1q25.1

Research Articles on ZBTB37

Similar Products

Product Notes

The ZBTB37 zbtb37 (Catalog #AAA1273609) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagaaag gtgggaacat acaattggag attcctgact tcagcaactc tgtcctgagc catctaaacc agttgcgcat gcagggccgt ctctgtgata ttgtggtcaa tgtgcaagga caagcttttc gggctcacaa agtggtgctg gctgccagct ccccctattt ccgggatcac atgtccttga atgagatgag tacagtctcc atttcagtca tcaagaaccc tactgttttt gaacagctcc tttctttctg ttacacaggg cggatatgcc tgcaactggc agatatcatc agctacctaa cagctgccag ttttctgcaa atgcagcata ttatagacaa atgtacacag atcctggagg gcattcattt caaaattaat gtggctgagg ttgaagcaga attaagtcaa acaaggacaa agcatcaaga gagacctcca gagtctcaca gggttacacc aaatctcaac cgctccctta gcccacgaca taatacccca aagggaaacc ggcgaggtca ggttagtgct gtgctggata tcagagagct aagtcctcct gaggagtcca ccagccctca gatcattgaa ccaagttctg atgtagagag ccgggagccc attcttcgga tcaaccgagc aggacagtgg tatgtggaga caggagtggc ggaccgtggg ggtcggagtg atgatgaagt tagagttctt ggagcagtac acatcaaaac tgaaaatctg gaggagtggc ttgggcctga gaatcagcct tctggagaag atgggagtag tgcagaggaa gtaacagcca tggtgattga taccacaggc catggttctg taggacagga aaattatact ttagggtctt caggagccaa ggtggctcgg ccaacaagca gtgaagttga cagatttagc ccctccggca gtgttgttcc cttgacagag agacacagag ccagaagtga gtctcctggg agaatggatg agcctaagca acccagctcc caggtatgga gttgtggatt tagaactgct ttggtggttg gaggaattgc tactgtgtat gaatag. It is sometimes possible for the material contained within the vial of "ZBTB37, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.