Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZADH2 cdna clone

ZADH2 cDNA Clone

Synonyms
ZADH2; ZADH2 cDNA Clone; ZADH2 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgcggctggtgcccaccggggcccgggccatcgtggacatgtcgtacgcccgccacttcctggacttccagggctccgccattccccaagccatgcagaagctggtggtgacccggctgagccccaacttccgcgaggccgtcaccctgagccgggactgcccggtgccgctccccggggacggagacctcctcgtccggaaccgatttgttggtgttaatgcatctgacatcaactattcagcaggccgctatgacccctcagttaagcctccctttgacataggtttcgaaggcattggggaggtggtggccctaggcctctctgctagtgccagatacacagttggccaagctgtggcttacatggcacctggttcttttgctgagtacacagttgtgcctgccagcattgcaactccagtgccctcagtgaaacccgagtatcttaccctgctggtaagtggcaccaccgcatacatcagcctgaaagagctcggaggactgtcggaagggaaaaaagttttggtgacagcagcagctgggggaacgggccagtttgccatgcagctttcaaagaaggcaaagtgccatgtaattggaacctgctcttctgatgaaaagtctgcttttctgaaatctcttggctgtgatcgtcctatcaactataaaactgaacccgtaggtaccgtccttaagcaggagtaccctgaaggtgtcgatgtggtctatgaatctgttgggggagccatgtttgacttggctgtagacgccctggctacgaaagggcgcttgatagtaatagggtttatctctggctaccaaactcctactggcctttcgcctgtgaaagcaggaacattgccagccaaactgctcaagaaatctgccagcgtacagggcttcttcctgaaccattacctttctaagtatcaagcagccatgagccacttgctcgagatgtgtgtgagcggagacctggtttgtgaggtggaccttggagatctgtctccagagggcaggtttactggcctggagtccatattccgtgctgtcaattatatgtacatgggaaaaaacactggaaaaattgtagttgaattacctcactctgtcaacagtaagctgtaa
Sequence Length
1134
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,900 Da
NCBI Official Full Name
Homo sapiens zinc binding alcohol dehydrogenase domain containing 2, mRNA
NCBI Official Synonym Full Names
zinc binding alcohol dehydrogenase domain containing 2
NCBI Official Symbol
ZADH2
NCBI Protein Information
zinc-binding alcohol dehydrogenase domain-containing protein 2
UniProt Protein Name
Zinc-binding alcohol dehydrogenase domain-containing protein 2
UniProt Gene Name
ZADH2
UniProt Entry Name
ZADH2_HUMAN

Uniprot Description

ZADH2: Belongs to the zinc-containing alcohol dehydrogenase family. Quinone oxidoreductase subfamily.

Protein type: EC 1.-.-.-; Oxidoreductase

Chromosomal Location of Human Ortholog: 18q22.3

Cellular Component: peroxisome

Research Articles on ZADH2

Similar Products

Product Notes

The ZADH2 zadh2 (Catalog #AAA1277914) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgcggc tggtgcccac cggggcccgg gccatcgtgg acatgtcgta cgcccgccac ttcctggact tccagggctc cgccattccc caagccatgc agaagctggt ggtgacccgg ctgagcccca acttccgcga ggccgtcacc ctgagccggg actgcccggt gccgctcccc ggggacggag acctcctcgt ccggaaccga tttgttggtg ttaatgcatc tgacatcaac tattcagcag gccgctatga cccctcagtt aagcctccct ttgacatagg tttcgaaggc attggggagg tggtggccct aggcctctct gctagtgcca gatacacagt tggccaagct gtggcttaca tggcacctgg ttcttttgct gagtacacag ttgtgcctgc cagcattgca actccagtgc cctcagtgaa acccgagtat cttaccctgc tggtaagtgg caccaccgca tacatcagcc tgaaagagct cggaggactg tcggaaggga aaaaagtttt ggtgacagca gcagctgggg gaacgggcca gtttgccatg cagctttcaa agaaggcaaa gtgccatgta attggaacct gctcttctga tgaaaagtct gcttttctga aatctcttgg ctgtgatcgt cctatcaact ataaaactga acccgtaggt accgtcctta agcaggagta ccctgaaggt gtcgatgtgg tctatgaatc tgttggggga gccatgtttg acttggctgt agacgccctg gctacgaaag ggcgcttgat agtaataggg tttatctctg gctaccaaac tcctactggc ctttcgcctg tgaaagcagg aacattgcca gccaaactgc tcaagaaatc tgccagcgta cagggcttct tcctgaacca ttacctttct aagtatcaag cagccatgag ccacttgctc gagatgtgtg tgagcggaga cctggtttgt gaggtggacc ttggagatct gtctccagag ggcaggttta ctggcctgga gtccatattc cgtgctgtca attatatgta catgggaaaa aacactggaa aaattgtagt tgaattacct cactctgtca acagtaagct gtaa. It is sometimes possible for the material contained within the vial of "ZADH2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.