YTHDF2 cdna clone

YTHDF2 cDNA Clone

Gene Names

YTHDF2; CAHL; HGRG8; NY-REN-2

Synonyms

YTHDF2; YTHDF2 cDNA Clone; YTHDF2 cdna clone

Ordering
Cat. Num. AAA1274450 For Research Use Only!

Sequence

atgtcggccagcagcctcttggagcagagaccaaaaggtcaaggaaacaaagtacaaaatggatctgtacatcaaaaggatggattaaacgatgatgattttgaaccttacttgagtccacaggcaaggcccaataatgcatatactgccatgtcagattcctacttacccagttactacagtccctccattggcttctcctattctttgggtgaagctgcttggtctacggggggtgacacagccatgccctacttaacttcttatggacagctgagcaacggagagccccacttcctaccagatgcaatgtttgggcaaccaggagccctaggtagcactccatttcttggtcagcatggttttaatttctttcccagtgggattgacttctcagcatggggaaataacagttctcagggacagtctactcagagctctggatatagtagcaattatgcttatgcacctagctccttaggtggagccatgattgatggacagtcagcttttgccaatgagaccctcaataaggctcctggcatgaatactatagaccaagggatggcagcactgaagttgggtagcacagaagttgcaagcaatgttccaaaagttgtaggttctgctgttggtagcgggtccattactagtaacatcgtggcttccaatagtttgcctccagccaccattgctcctccaaaaccagcatcttgggctgatattgctagcaagcctgcaaaacagcaacctaaactgaagaccaagaatggcattgcagggtcaagtcttccgccacccccgataaagcataacatggatattggaacttgggataacaagggtcccgttgcaaaagccccctcacaggctttggttcagaatataggtcagccaacccaggggtctcctcagcctgtaggtcagcaggctaacaatagcccaccagtggctcaggcatcagtagggcaacagacacagccattgcctccacctccaccacagcctgcccagctttcagtccagcaacaggcagctcagccaacccgctgggtagcacctcggaaccgtggcagtgggttcggtcataatggggtggatggtaatggagtaggacagtctcaggctggttctggatctactccttcagaaccccacccagtgttggagaagcttcggtccattaataactataaccccaaagattttgactggaatctgaaacatggccgggttttcatcattaagagctactctgaggacgatattcaccgttccattaagtataatatttggtgcagcacagagcatggtaacaagagactggatgctgcttatcgttccatgaacgggaaaggccccgtttacttacttttcagtgtcaacggcagtggacacttctgtggcgtggcagaaatgaaatctgctgtggactacaacacatgtgcaggtgtgtggtcccaggacaaatggaagggtcgttttgatgtcaggtggatttttgtgaaggacgttcccaatagccaactgcgacacattcgcctagagaacaacgagaataaaccagtgaccaactctagggacactcaggaagtgcctctggaaaaggctaagcaggtgttgaaaattatagccagctacaagcacaccacttccatttttgatgacttctcacactatgagaaacgccaagaggaagaagaaagtgttaaaaaggaacgtcaaggtcgtgggaaataa

Sequence Length

1740

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

33990650

NCBI GeneID

51441

Molecular Weight

56,877 Da

NCBI Official Full Name

Homo sapiens YTH domain family, member 2, mRNA

NCBI Official Synonym Full Names

YTH N6-methyladenosine RNA binding protein 2

NCBI Official Symbol

YTHDF2

NCBI Official Synonym Symbols

CAHL; HGRG8; NY-REN-2

NCBI Protein Information

YTH domain-containing family protein 2

UniProt Protein Name

YTH domain-containing family protein 2

Protein Family

YTH domain-containing family protein

UniProt Gene Name

YTHDF2

UniProt Entry Name

YTHD2_HUMAN

NCBI Description

This gene encodes a member of the YTH (YT521-B homology) superfamily containing YTH domain. The YTH domain is typical for the eukaryotes and is particularly abundant in plants. The YTH domain is usually located in the middle of the protein sequence and may function in binding to RNA. In addition to a YTH domain, this protein has a proline rich region which may be involved in signal transduction. An Alu-rich domain has been identified in one of the introns of this gene, which is thought to be associated with human longevity. In addition, reciprocal translocations between this gene and the Runx1 (AML1) gene on chromosome 21 has been observed in patients with acute myeloid leukemia. This gene was initially mapped to chromosome 14, which was later turned out to be a pseudogene. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Oct 2012]

Uniprot Description

YTHDF2: high glucose-regulated protein 8. Two alternatively spliced isoforms have been described.

Protein type: RNA-binding; RNA processing

Chromosomal Location of Human Ortholog: 1p35

Cellular Component: cytoplasm; cytosol; nucleus

Molecular Function: protein binding

Biological Process: humoral immune response; regulation of mRNA stability

Disease: Longevity 1

Research Articles on YTHDF2

1. binding affinities of the YTH domains of three human proteins and yeast YTH domain protein Pho92

Similar Products

Product Notes

The YTHDF2 ythdf2 (Catalog #AAA1274450) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggcca gcagcctctt ggagcagaga ccaaaaggtc aaggaaacaa agtacaaaat ggatctgtac atcaaaagga tggattaaac gatgatgatt ttgaacctta cttgagtcca caggcaaggc ccaataatgc atatactgcc atgtcagatt cctacttacc cagttactac agtccctcca ttggcttctc ctattctttg ggtgaagctg cttggtctac ggggggtgac acagccatgc cctacttaac ttcttatgga cagctgagca acggagagcc ccacttccta ccagatgcaa tgtttgggca accaggagcc ctaggtagca ctccatttct tggtcagcat ggttttaatt tctttcccag tgggattgac ttctcagcat ggggaaataa cagttctcag ggacagtcta ctcagagctc tggatatagt agcaattatg cttatgcacc tagctcctta ggtggagcca tgattgatgg acagtcagct tttgccaatg agaccctcaa taaggctcct ggcatgaata ctatagacca agggatggca gcactgaagt tgggtagcac agaagttgca agcaatgttc caaaagttgt aggttctgct gttggtagcg ggtccattac tagtaacatc gtggcttcca atagtttgcc tccagccacc attgctcctc caaaaccagc atcttgggct gatattgcta gcaagcctgc aaaacagcaa cctaaactga agaccaagaa tggcattgca gggtcaagtc ttccgccacc cccgataaag cataacatgg atattggaac ttgggataac aagggtcccg ttgcaaaagc cccctcacag gctttggttc agaatatagg tcagccaacc caggggtctc ctcagcctgt aggtcagcag gctaacaata gcccaccagt ggctcaggca tcagtagggc aacagacaca gccattgcct ccacctccac cacagcctgc ccagctttca gtccagcaac aggcagctca gccaacccgc tgggtagcac ctcggaaccg tggcagtggg ttcggtcata atggggtgga tggtaatgga gtaggacagt ctcaggctgg ttctggatct actccttcag aaccccaccc agtgttggag aagcttcggt ccattaataa ctataacccc aaagattttg actggaatct gaaacatggc cgggttttca tcattaagag ctactctgag gacgatattc accgttccat taagtataat atttggtgca gcacagagca tggtaacaag agactggatg ctgcttatcg ttccatgaac gggaaaggcc ccgtttactt acttttcagt gtcaacggca gtggacactt ctgtggcgtg gcagaaatga aatctgctgt ggactacaac acatgtgcag gtgtgtggtc ccaggacaaa tggaagggtc gttttgatgt caggtggatt tttgtgaagg acgttcccaa tagccaactg cgacacattc gcctagagaa caacgagaat aaaccagtga ccaactctag ggacactcag gaagtgcctc tggaaaaggc taagcaggtg ttgaaaatta tagccagcta caagcacacc acttccattt ttgatgactt ctcacactat gagaaacgcc aagaggaaga agaaagtgtt aaaaaggaac gtcaaggtcg tgggaaataa. It is sometimes possible for the material contained within the vial of "YTHDF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

YTHDF2 cdna clone