YME1L1 cdna clone
YME1L1 cDNA Clone
Gene Names
YME1L1; FTSH; MEG4; PAMP; YME1L
Synonyms
YME1L1; YME1L1 cDNA Clone; YME1L1 cdna clone
Sequence
atgttttccttgtcgagcacggtgcaaccccaggttacagttcctctgagtcatctcatcaatgccttccatacaccaaaaaacacttctgtttctctcagtggagtgtcagtttctcaaaaccagcatcgagatgtagttcctgagcatgaggctcccagcagtgagccttcacttaacttaagggaccttggattatctgaactaaaaattggacagattgatcagctggtagaaaatctacttcctggattttgtaaaggcaaaaacatttcttcccattggcatacatcccatgtctctgcacaatccttctttgaaaataaatatggtaacttagatatatttagtacattacgttcctcttgcttgtatcgacatcattcaagagctcttcaaagcatttgttcagatcttcagtactggccagttttcatacagtctcggggttttaaaactttgaaatcaaggacacgacgtctccagtctacctccgagagattagctgaaacacagaatatagcgccatcattcgtgaaggggtttcttttgcgggacagaggatcagatgttgagagtttggacaaactcatgaaaaccaaaaatatacctgaagctcaccaagatgcatttaaaactggttttgcggaaggttttctgaaagctcaagcactcacacaaaaaaccaatgattccctaaggcgaacccgtctgattctcttcgttctgctgctattcggcatttatggacttctaaaaaacccatttttatctgtccgcttccggacaacaacagggcttgattctgcagtagatcctgtccagatgaaaaatgtcacctttgaacatgttaaaggggtggaggaagctaaacaagaattacaggaagttgttgaattcttgaaaaatccacaaaaatttactattcttggaggtaaacttccaaaaggaattcttttagttggacccccagggactggaaagacacttcttgcccgagctgtggcgggagaagctgatgttcctttttattatgcttctggatccgaatttgatgagatgtttgtgggtgtgggagccagccgtatcagaaatctttttagggaagcaaaggcgaatgctccttgtgttatatttattgatgaattagattctgttggtgggaagagaattgaatctccaatgcatccatattcaaggcagaccataaatcaacttcttgctgaaatggatggttttaaacccaatgaaggagttatcataataggagccacaaacttcccagaggcattagataatgccttaatacgtcctggtcgttttgacatgcaagttacagttccaaggccagatgtaaaaggtcgaacagaaattttgaaatggtatctcaataaaataaagtttgatcaatccgttgatccagaaattatagctcgaggtactgttggcttttccggagcagagttggagaatcttgtgaaccaggctgcattaaaagcagctgttgatggaaaagaaatggttaccatgaaggagctggagttttccaaagacaaaattctaatggggcctgaaagaagaagtgtggaaattgataacaaaaacaaaaccatcacagcatatcatgaatctggtcatgccattattgcatattacacaaaagatgcaatgcctatcaacaaagctacaatcatgccacgggggccaacacttggacatgtgtccctgttacctgagaatgacagatggaatgaaactagagcccagctgcttgcacaaatggatgttagtatgggaggaagagtggcagaggagcttatatttggaaccgaccatattacaacaggtgcttccagtgattttgataatgccactaaaatagcaaagcggatggttaccaaatttggaatgagtgaaaagcttggagttatgacctacagtgatacagggaaactaagtccagaaacccaatctgccatcgaacaagaaataagaatccttctaagggactcatatgaacgagcaaaacatatcttgaaaactcatgcaaaggagcataagaatctcgcagaagctttattgacctatgagactttggatgccaaagagattcaaattgttcttgaggggaaaaagttggaagtgagatga
Sequence Length
2151
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
75,982 Da
NCBI Official Full Name
Homo sapiens YME1-like 1 (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
YME1 like 1 ATPase
NCBI Official Symbol
YME1L1
NCBI Official Synonym Symbols
FTSH; MEG4; PAMP; YME1L
NCBI Protein Information
ATP-dependent zinc metalloprotease YME1L1
UniProt Protein Name
ATP-dependent zinc metalloprotease YME1L1
Protein Family
UniProt Gene Name
YME1L1
UniProt Synonym Gene Names
FTSH1; YME1L; PAMP
UniProt Entry Name
YMEL1_HUMAN
NCBI Description
The protein encoded by this gene is the human ortholog of yeast mitochondrial AAA metalloprotease, Yme1p. It is localized in the mitochondria and can functionally complement a yme1 disruptant yeast strain. It is proposed that this gene plays a role in mitochondrial protein metabolism and could be involved in mitochondrial pathologies. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Uniprot Description
YME1L1: Putative ATP-dependent protease which plays a role in mitochondrial protein metabolism. Ensures cell proliferation, maintains normal cristae morphology and complex I respiration activity, promotes antiapoptotic activity and protects mitochondria from the accumulation of oxidatively damaged membrane proteins. Requires to control the accumulation of nonassembled respiratory chain subunits (NDUFB6, OX4 and ND1). Seems to act in the processing of OPA1. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Protease; Mitochondrial; EC 3.4.24.-
Chromosomal Location of Human Ortholog: 10p14
Cellular Component: membrane; mitochondrial inner membrane; mitochondrion; nucleoplasm
Molecular Function: ATP-dependent peptidase activity; metallopeptidase activity
Biological Process: cell proliferation; misfolded or incompletely synthesized protein catabolic process; mitochondrion organization and biogenesis
Research Articles on YME1L1
Similar Products
Product Notes
The YME1L1 yme1l1 (Catalog #AAA1273137) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttttcct tgtcgagcac ggtgcaaccc caggttacag ttcctctgag tcatctcatc aatgccttcc atacaccaaa aaacacttct gtttctctca gtggagtgtc agtttctcaa aaccagcatc gagatgtagt tcctgagcat gaggctccca gcagtgagcc ttcacttaac ttaagggacc ttggattatc tgaactaaaa attggacaga ttgatcagct ggtagaaaat ctacttcctg gattttgtaa aggcaaaaac atttcttccc attggcatac atcccatgtc tctgcacaat ccttctttga aaataaatat ggtaacttag atatatttag tacattacgt tcctcttgct tgtatcgaca tcattcaaga gctcttcaaa gcatttgttc agatcttcag tactggccag ttttcataca gtctcggggt tttaaaactt tgaaatcaag gacacgacgt ctccagtcta cctccgagag attagctgaa acacagaata tagcgccatc attcgtgaag gggtttcttt tgcgggacag aggatcagat gttgagagtt tggacaaact catgaaaacc aaaaatatac ctgaagctca ccaagatgca tttaaaactg gttttgcgga aggttttctg aaagctcaag cactcacaca aaaaaccaat gattccctaa ggcgaacccg tctgattctc ttcgttctgc tgctattcgg catttatgga cttctaaaaa acccattttt atctgtccgc ttccggacaa caacagggct tgattctgca gtagatcctg tccagatgaa aaatgtcacc tttgaacatg ttaaaggggt ggaggaagct aaacaagaat tacaggaagt tgttgaattc ttgaaaaatc cacaaaaatt tactattctt ggaggtaaac ttccaaaagg aattctttta gttggacccc cagggactgg aaagacactt cttgcccgag ctgtggcggg agaagctgat gttccttttt attatgcttc tggatccgaa tttgatgaga tgtttgtggg tgtgggagcc agccgtatca gaaatctttt tagggaagca aaggcgaatg ctccttgtgt tatatttatt gatgaattag attctgttgg tgggaagaga attgaatctc caatgcatcc atattcaagg cagaccataa atcaacttct tgctgaaatg gatggtttta aacccaatga aggagttatc ataataggag ccacaaactt cccagaggca ttagataatg ccttaatacg tcctggtcgt tttgacatgc aagttacagt tccaaggcca gatgtaaaag gtcgaacaga aattttgaaa tggtatctca ataaaataaa gtttgatcaa tccgttgatc cagaaattat agctcgaggt actgttggct tttccggagc agagttggag aatcttgtga accaggctgc attaaaagca gctgttgatg gaaaagaaat ggttaccatg aaggagctgg agttttccaa agacaaaatt ctaatggggc ctgaaagaag aagtgtggaa attgataaca aaaacaaaac catcacagca tatcatgaat ctggtcatgc cattattgca tattacacaa aagatgcaat gcctatcaac aaagctacaa tcatgccacg ggggccaaca cttggacatg tgtccctgtt acctgagaat gacagatgga atgaaactag agcccagctg cttgcacaaa tggatgttag tatgggagga agagtggcag aggagcttat atttggaacc gaccatatta caacaggtgc ttccagtgat tttgataatg ccactaaaat agcaaagcgg atggttacca aatttggaat gagtgaaaag cttggagtta tgacctacag tgatacaggg aaactaagtc cagaaaccca atctgccatc gaacaagaaa taagaatcct tctaagggac tcatatgaac gagcaaaaca tatcttgaaa actcatgcaa aggagcataa gaatctcgca gaagctttat tgacctatga gactttggat gccaaagaga ttcaaattgt tcttgagggg aaaaagttgg aagtgagatg a. It is sometimes possible for the material contained within the vial of "YME1L1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
