Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

XYLB cdna clone

XYLB cDNA Clone

Synonyms
XYLB; XYLB cDNA Clone; XYLB cdna clone
Ordering
For Research Use Only!
Sequence
atggcggagcacgcccctcgccgctgctgcctgggctgggacttcagcacgcagcaggtaaaggttgttgctgttgatgcagagttgaatgtcttctatgaggaaagtgtgcattttgacagagatcttccagaatttgggactcagggcggtgttcatgtgcacaaggatgggctgacggtcacttctccagtactaatgtgggtccaggcactggatatcatcttggagaagatgaaggcttcgggcttcgaattctctcaagtcctagccttgtccggggcgggccagcaacacggaagtatatactggaaggctggagcccagcaggcactgacaagcttatcaccagacctccggctacaccagcagcttcaggactgtttttccatcagcgactgcccggtgtggatggactccagcaccacagcccagtgccgccagctggaggctgctgtgggtggtgctcaggctctcagctgcctcacggggtcccgtgcctatgagcgttttacagggaaccaaattgcaaaaatttaccagcagaaccccgaggcctactcacatacagagagaatttctttggtcagtagctttgctgcttccctgttccttggctcttactcccctattgactacagtgatggttctggaatgaatttgttgcagatacaggataaagtctggtcccaggcttgccttggtgcctgtgcacctcatttagaggagaagcttagcccaccagtaccatcatgctcagttgtgggagccatttcttcctactacgtccagcgctacggatttcctccaggatgcaaagtggtggccttcactggggacaacccagcgtcgctggcaggcatgagactggaggaaggtgacattgcggtcagcctgggcaccagtgacaccctgtttctctggctccaagagcccatgcctgccctggaaggccacatcttctgcaacccggttgactcccagcactacatggcactcctgtgctttaaaaatggctccctcatgagagagaagatccgcaacgagtctgtatcccgttcctggagcgatttctctaaggcactgcagtccacagagatgggcaacggtggaaacctgggtttttattttgatgtaatggagatcacccctgaaattattggacgtcataggtttaacacagaaaaccacaaggttgcagcattccctggggatgtggaggttcgagcactaattgaaggacaattcatggccaagaggattcacgcagaaggcctgggctatcgagtcatgtccaagacaaagattttggccacaggaggagcatctcacaatagagaaatcttacaggtgcttgcagatgtgttgatgccccggtgtatgttatag
Sequence Length
1389
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,182 Da
NCBI Official Full Name
Homo sapiens cDNA clone IMAGE:6166461, containing frame-shift errors
NCBI Official Synonym Full Names
xylulokinase
NCBI Official Symbol
XYLB
NCBI Protein Information
xylulose kinase
UniProt Protein Name
Xylulose kinase
Protein Family
UniProt Gene Name
XYLB
UniProt Synonym Gene Names
Xylulokinase
UniProt Entry Name
XYLB_HUMAN

NCBI Description

The protein encoded by this gene shares 22% sequence identity with Hemophilus influenzae xylulokinase, and even higher identity to other gene products in C.elegans (45%) and yeast (31-35%), which are thought to belong to a family of enzymes that include fucokinase, gluconokinase, glycerokinase and xylulokinase. These proteins play important roles in energy metabolism. [provided by RefSeq, Aug 2009]

Uniprot Description

XYLB: shares 22% sequence identity with Hemophilus influenzae xylulokinase, and even higher identity to other gene products in C.elegans (45%) and yeast (31-35%), which are thought to belong to a family of enzymes that include fucokinase, gluconokinase, glycerokinase and xylulokinase. These proteins play important roles in energy metabolism. [provided by RefSeq, Aug 2009]

Protein type: Carbohydrate Metabolism - pentose and glucuronate interconversions; EC 2.7.1.17; Kinase, other

Chromosomal Location of Human Ortholog: 3p22-p21.3

Cellular Component: cytoplasm; cytosol

Molecular Function: xylulokinase activity

Biological Process: carbohydrate metabolic process; generation of precursor metabolites and energy; glucuronate catabolic process to xylulose 5-phosphate; xylulose catabolic process; xylulose metabolic process

Research Articles on XYLB

Similar Products

Product Notes

The XYLB xylb (Catalog #AAA1273302) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggagc acgcccctcg ccgctgctgc ctgggctggg acttcagcac gcagcaggta aaggttgttg ctgttgatgc agagttgaat gtcttctatg aggaaagtgt gcattttgac agagatcttc cagaatttgg gactcagggc ggtgttcatg tgcacaagga tgggctgacg gtcacttctc cagtactaat gtgggtccag gcactggata tcatcttgga gaagatgaag gcttcgggct tcgaattctc tcaagtccta gccttgtccg gggcgggcca gcaacacgga agtatatact ggaaggctgg agcccagcag gcactgacaa gcttatcacc agacctccgg ctacaccagc agcttcagga ctgtttttcc atcagcgact gcccggtgtg gatggactcc agcaccacag cccagtgccg ccagctggag gctgctgtgg gtggtgctca ggctctcagc tgcctcacgg ggtcccgtgc ctatgagcgt tttacaggga accaaattgc aaaaatttac cagcagaacc ccgaggccta ctcacataca gagagaattt ctttggtcag tagctttgct gcttccctgt tccttggctc ttactcccct attgactaca gtgatggttc tggaatgaat ttgttgcaga tacaggataa agtctggtcc caggcttgcc ttggtgcctg tgcacctcat ttagaggaga agcttagccc accagtacca tcatgctcag ttgtgggagc catttcttcc tactacgtcc agcgctacgg atttcctcca ggatgcaaag tggtggcctt cactggggac aacccagcgt cgctggcagg catgagactg gaggaaggtg acattgcggt cagcctgggc accagtgaca ccctgtttct ctggctccaa gagcccatgc ctgccctgga aggccacatc ttctgcaacc cggttgactc ccagcactac atggcactcc tgtgctttaa aaatggctcc ctcatgagag agaagatccg caacgagtct gtatcccgtt cctggagcga tttctctaag gcactgcagt ccacagagat gggcaacggt ggaaacctgg gtttttattt tgatgtaatg gagatcaccc ctgaaattat tggacgtcat aggtttaaca cagaaaacca caaggttgca gcattccctg gggatgtgga ggttcgagca ctaattgaag gacaattcat ggccaagagg attcacgcag aaggcctggg ctatcgagtc atgtccaaga caaagatttt ggccacagga ggagcatctc acaatagaga aatcttacag gtgcttgcag atgtgttgat gccccggtgt atgttatag. It is sometimes possible for the material contained within the vial of "XYLB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.