Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

XRCC6 cdna clone

XRCC6 cDNA Clone

Gene Names
XRCC6; ML8; KU70; TLAA; CTC75; CTCBF; G22P1
Synonyms
XRCC6; XRCC6 cDNA Clone; XRCC6 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcagggtgggagtcatattacaaaaccgagggcgatgaagaagcagaggaagaacaagaagagaaccttgaagcaagtggagactataaatattcaggaagagatagtttgatttttttggttgatgcctccaaggctatgtttgaatctcagagtgaagatgagttgacaccttttgacatgagcatccagtgtatccaaagtgtgtacatcagtaagatcataagcagtgatcgagatctcttggctgtggtgttctatggtaccgagaaagacaaaaattcagtgaattttaaaaatatttacgtcttacaggagctggataatccaggtgcaaaacgaattctagagcttgaccagtttaaggggcagcagggacaaaaacgtttccaagacatgatgggccacggatctgactactcactcagtgaagtgctgtgggtctgtgccaacctctttagtgatgtccaattcaagatgagtcataagaggatcatgctgttcaccaatgaagacaacccccatggcaatgacagtgccaaagccagccgggccaggaccaaagccggtgatctccgagatacaggcatcttccttgacttgatgcacctgaagaaacctgggggctttgacatatccttgttctacagagatatcatcagcatagcagaggatgaggacctcagggttcactttgaggaatccagcaagctagaagacctgttgcggaaggttcgcgccaaggagaccaggaagcgagcactcagcaggttaaagctgaagctcaacaaagatatagtgatctctgtgggcatttataatctggtccagaaggctctcaagcctcctccaataaagctctatcgggaaacaaatgaaccagtgaaaaccaagacccggacctttaatacaagtacaggcggtttgcttctgcctagcgataccaagaggtctcagatctatgggagtcgtcagattatactggagaaagaggaaacagaagagctaaaacggtttgatgatccaggtttgatgctcatgggtttcaagccgttggtactgctgaagaaacaccattacctgaggccctccctgttcgtgtacccagaggagtcgctggtgattgggagctcaaccctgttcagtgctctgctcatcaagtgtctggagaaggaggttgcagcattgtgcagatacacaccccgcaggaacatccctccttattttgtggctttggtgccacaggaagaagagttggatgaccagaaaattcaggtgactcctccaggcttccagctggtctttttaccctttgctgatgataaaaggaagatgccctttactgaaaaaatcatggcaactccagagcaggtgggcaagatgaaggctatcgttgagaagcttcgcttcacatacagaagtgacagctttgagaaccccgtgctgcagcagcacttcaggaacctggaggccttggccttggatttgatggagccggaacaagcagtggacctgacattgcccaaggttgaagcaatgaataaaagactgggctccttggtggatgagtttaaggagcttgtttacccaccagattacaatcctgaagggaaagttaccaagagaaaacacgataatgaaggttctggaagcaaaaggcccaaggtggagtattcagaagaggagctgaagacccacatcagcaagggtacgctgggcaagttcactgtgcccatgctgaaagaggcctgccgggcttacgggctgaagagtggtctgaagaagcaggagctgctggaagccctcaccaagcacttccaggactga
Sequence Length
1830
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
65,149 Da
NCBI Official Full Name
Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 6, mRNA
NCBI Official Synonym Full Names
X-ray repair cross complementing 6
NCBI Official Symbol
XRCC6
NCBI Official Synonym Symbols
ML8; KU70; TLAA; CTC75; CTCBF; G22P1
NCBI Protein Information
X-ray repair cross-complementing protein 6
UniProt Protein Name
X-ray repair cross-complementing protein 6
UniProt Gene Name
XRCC6
UniProt Synonym Gene Names
G22P1; 5'-dRP lyase Ku70; CTC75; CTCBF; Ku70; TLAA
UniProt Entry Name
XRCC6_HUMAN

NCBI Description

The p70/p80 autoantigen is a nuclear complex consisting of two subunits with molecular masses of approximately 70 and 80 kDa. The complex functions as a single-stranded DNA-dependent ATP-dependent helicase. The complex may be involved in the repair of nonhomologous DNA ends such as that required for double-strand break repair, transposition, and V(D)J recombination. High levels of autoantibodies to p70 and p80 have been found in some patients with systemic lupus erythematosus. [provided by RefSeq, Jul 2008]

Uniprot Description

Ku70: a mini-chromosome maintenance protein, essential for the initiation of eukaryotic genome replication. Allows DNA to undergo a single round of replication per cell cycle. Required for the entry in S phase and for cell division.

Protein type: DNA repair, damage; DNA-binding; EC 4.2.99.-; Nuclear receptor co-regulator; RNA-binding; EC 3.6.4.-; Helicase

Chromosomal Location of Human Ortholog: 22q13.2

Cellular Component: cytosol; membrane; nuclear chromosome, telomeric region; nuclear telomere cap complex; nucleoplasm; nucleus; transcription factor complex

Molecular Function: 5'-deoxyribose-5-phosphate lyase activity; damaged DNA binding; double-stranded DNA binding; double-stranded telomeric DNA binding; protein binding; protein C-terminus binding

Biological Process: DNA ligation; DNA recombination; double-strand break repair via nonhomologous end joining; negative regulation of transcription, DNA-dependent; positive regulation of interferon type I production; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; protein heterotetramerization; regulation of smooth muscle cell proliferation; telomere maintenance

Research Articles on XRCC6

Similar Products

Product Notes

The XRCC6 xrcc6 (Catalog #AAA1269010) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcagggt gggagtcata ttacaaaacc gagggcgatg aagaagcaga ggaagaacaa gaagagaacc ttgaagcaag tggagactat aaatattcag gaagagatag tttgattttt ttggttgatg cctccaaggc tatgtttgaa tctcagagtg aagatgagtt gacacctttt gacatgagca tccagtgtat ccaaagtgtg tacatcagta agatcataag cagtgatcga gatctcttgg ctgtggtgtt ctatggtacc gagaaagaca aaaattcagt gaattttaaa aatatttacg tcttacagga gctggataat ccaggtgcaa aacgaattct agagcttgac cagtttaagg ggcagcaggg acaaaaacgt ttccaagaca tgatgggcca cggatctgac tactcactca gtgaagtgct gtgggtctgt gccaacctct ttagtgatgt ccaattcaag atgagtcata agaggatcat gctgttcacc aatgaagaca acccccatgg caatgacagt gccaaagcca gccgggccag gaccaaagcc ggtgatctcc gagatacagg catcttcctt gacttgatgc acctgaagaa acctgggggc tttgacatat ccttgttcta cagagatatc atcagcatag cagaggatga ggacctcagg gttcactttg aggaatccag caagctagaa gacctgttgc ggaaggttcg cgccaaggag accaggaagc gagcactcag caggttaaag ctgaagctca acaaagatat agtgatctct gtgggcattt ataatctggt ccagaaggct ctcaagcctc ctccaataaa gctctatcgg gaaacaaatg aaccagtgaa aaccaagacc cggaccttta atacaagtac aggcggtttg cttctgccta gcgataccaa gaggtctcag atctatggga gtcgtcagat tatactggag aaagaggaaa cagaagagct aaaacggttt gatgatccag gtttgatgct catgggtttc aagccgttgg tactgctgaa gaaacaccat tacctgaggc cctccctgtt cgtgtaccca gaggagtcgc tggtgattgg gagctcaacc ctgttcagtg ctctgctcat caagtgtctg gagaaggagg ttgcagcatt gtgcagatac acaccccgca ggaacatccc tccttatttt gtggctttgg tgccacagga agaagagttg gatgaccaga aaattcaggt gactcctcca ggcttccagc tggtcttttt accctttgct gatgataaaa ggaagatgcc ctttactgaa aaaatcatgg caactccaga gcaggtgggc aagatgaagg ctatcgttga gaagcttcgc ttcacataca gaagtgacag ctttgagaac cccgtgctgc agcagcactt caggaacctg gaggccttgg ccttggattt gatggagccg gaacaagcag tggacctgac attgcccaag gttgaagcaa tgaataaaag actgggctcc ttggtggatg agtttaagga gcttgtttac ccaccagatt acaatcctga agggaaagtt accaagagaa aacacgataa tgaaggttct ggaagcaaaa ggcccaaggt ggagtattca gaagaggagc tgaagaccca catcagcaag ggtacgctgg gcaagttcac tgtgcccatg ctgaaagagg cctgccgggc ttacgggctg aagagtggtc tgaagaagca ggagctgctg gaagccctca ccaagcactt ccaggactga. It is sometimes possible for the material contained within the vial of "XRCC6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.