Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

XRCC3 cdna clone

XRCC3 cDNA Clone

Gene Names
XRCC3; CMM6
Synonyms
XRCC3; XRCC3 cDNA Clone; XRCC3 cdna clone
Ordering
For Research Use Only!
Sequence
atggatttggatctactggacctgaatcccagaattattgctgcaattaagaaagccaaactgaaatcggtaaaggaggttttacacttttctggaccagacttgaagagactgaccaacctctccagccccgaggtctggcacttgctgagaacggcctccttacacttgcggggaagcagcatccttacagcactgcagctgcaccagcagaaggagcggttccccacgcagcaccagcgcctgagcctgggctgcccggtgctggacgcgctgctccgcggtggcctgcccctggacggcatcactgagctggccggacgcagctcggcagggaagacccagctggcgctgcagctctgcctggctgtgcagttcccgcggcagcacggaggcctggaggctggagccgtctacatctgcacggaagacgccttcccgcacaagcgcctgcagcagctcatggcccagcagccgcggctgcgcactgacgttccaggagagctgcttcagaagctccgatttggcagccagatcttcatcgagcacgtggccgatgtggacaccttgttggagtgtgtgaataagaaggtccccgtactgctgtctcggggcatggctcgcctggtggtcatcgactcggtggcagccccattccgctgtgaatttgacagccaggcctccgcccccagggccaggcatctgcagtccctgggggccacgctgcgtgagctgagcagtgccttccagagccctgtgctgtgcatcaaccaggtgacagaggccatggaggagcagggcgcagcacacgggccgctggggttctgggacgaacgtgtttccccagcccttggcataacctgggctaaccagctcctggtgagactgctggctgaccggctccgcgaggaagaggctgccctcggctgcccagcccggaccctgcgggtgctctctgccccccacctgcccccctcctcctgttcctacacgatcagtgccgaaggggtgcgagggacacctgggacccagtcccactga
Sequence Length
1041
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,850 Da
NCBI Official Full Name
Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 3, mRNA
NCBI Official Synonym Full Names
X-ray repair cross complementing 3
NCBI Official Symbol
XRCC3
NCBI Official Synonym Symbols
CMM6
NCBI Protein Information
DNA repair protein XRCC3
UniProt Protein Name
DNA repair protein XRCC3
Protein Family
UniProt Gene Name
XRCC3
UniProt Entry Name
XRCC3_HUMAN

NCBI Description

This gene encodes a member of the RecA/Rad51-related protein family that participates in homologous recombination to maintain chromosome stability and repair DNA damage. This gene functionally complements Chinese hamster irs1SF, a repair-deficient mutant that exhibits hypersensitivity to a number of different DNA-damaging agents and is chromosomally unstable. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

XRCC3: Involved in the homologous recombination repair (HRR) pathway of double-stranded DNA, thought to repair chromosomal fragmentation, translocations and deletions. Plays a role in regulating mitochondrial DNA copy number under conditions of oxidative stress in the presence of RAD51 and RAD51C. Defects in XRCC3 are the cause of susceptibility to breast cancer (BC). BC is a common malignancy originating from breast epithelial tissue. Breast neoplasms can be distinguished by their histologic pattern. Invasive ductal carcinoma is by far the most common type. Breast cancer is etiologically and genetically heterogeneous. Important genetic factors have been indicated by familial occurrence and bilateral involvement. Mutations at more than one locus can be involved in different families or even in the same case. Defects in XRCC3 are the cause of susceptibility to cutaneous malignant melanoma type 6 (CMM6). CMM6 is a malignant neoplasm of melanocytes, arising de novo or from a pre- existing benign nevus, which occurs most often in the skin but also may involve other sites. Belongs to the RecA family. RAD51 subfamily.

Protein type: DNA repair, damage

Chromosomal Location of Human Ortholog: 14q32.3

Cellular Component: cytoplasm; mitochondrion; nuclear chromosome, telomeric region; nucleoplasm; nucleus; perinuclear region of cytoplasm; replication fork

Molecular Function: crossover junction endodeoxyribonuclease activity; DNA-dependent ATPase activity; double-stranded DNA binding; four-way junction DNA binding; protein binding; recombinase activity; single-stranded DNA binding

Biological Process: DNA recombination; DNA repair; DNA synthesis during DNA repair; double-strand break repair via homologous recombination; meiotic DNA recombinase assembly; meiotic recombination; response to DNA damage stimulus; response to ionizing radiation; strand displacement; strand invasion; telomere maintenance via recombination

Disease: Breast Cancer; Melanoma, Cutaneous Malignant, Susceptibility To, 6

Research Articles on XRCC3

Similar Products

Product Notes

The XRCC3 xrcc3 (Catalog #AAA1274853) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatttgg atctactgga cctgaatccc agaattattg ctgcaattaa gaaagccaaa ctgaaatcgg taaaggaggt tttacacttt tctggaccag acttgaagag actgaccaac ctctccagcc ccgaggtctg gcacttgctg agaacggcct ccttacactt gcggggaagc agcatcctta cagcactgca gctgcaccag cagaaggagc ggttccccac gcagcaccag cgcctgagcc tgggctgccc ggtgctggac gcgctgctcc gcggtggcct gcccctggac ggcatcactg agctggccgg acgcagctcg gcagggaaga cccagctggc gctgcagctc tgcctggctg tgcagttccc gcggcagcac ggaggcctgg aggctggagc cgtctacatc tgcacggaag acgccttccc gcacaagcgc ctgcagcagc tcatggccca gcagccgcgg ctgcgcactg acgttccagg agagctgctt cagaagctcc gatttggcag ccagatcttc atcgagcacg tggccgatgt ggacaccttg ttggagtgtg tgaataagaa ggtccccgta ctgctgtctc ggggcatggc tcgcctggtg gtcatcgact cggtggcagc cccattccgc tgtgaatttg acagccaggc ctccgccccc agggccaggc atctgcagtc cctgggggcc acgctgcgtg agctgagcag tgccttccag agccctgtgc tgtgcatcaa ccaggtgaca gaggccatgg aggagcaggg cgcagcacac gggccgctgg ggttctggga cgaacgtgtt tccccagccc ttggcataac ctgggctaac cagctcctgg tgagactgct ggctgaccgg ctccgcgagg aagaggctgc cctcggctgc ccagcccgga ccctgcgggt gctctctgcc ccccacctgc ccccctcctc ctgttcctac acgatcagtg ccgaaggggt gcgagggaca cctgggaccc agtcccactg a. It is sometimes possible for the material contained within the vial of "XRCC3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.