XPNPEP1 cdna clone

XPNPEP1 cDNA Clone

Gene Names

XPNPEP1; APP1; SAMP; XPNPEP; XPNPEPL; XPNPEPL1

Synonyms

XPNPEP1; XPNPEP1 cDNA Clone; XPNPEP1 cdna clone

Ordering
Cat. Num. AAA1271768 For Research Use Only!

Sequence

atgcctccaaaggtgacttcagagctgcttcggcagctgagacaagccatgaggaactctgagtatgtgaccgaaccgatccaggcctacatcatcccatcgggagatgctcatcagagtgagtatattgctccatgtgactgtcggcgggcttttgtctctggattcgatggctctgcgggcacagccatcatcacagaagagcatgcagccatgtggactgacgggcgctactttctccaggctgccaagcaaatggacagcaactggacacttatgaagatgggtctgaaggacacaccaactcaggaagactggctggtgagtgtgcttcctgaaggatccagggttggtgtggaccccttgatcattcctacagattattggaagaaaatggccaaagttctgagaagtgccggccatcacctcattcctgtcaaggagaacctcgttgacaaaatctggacagaccgtcctgagcgcccttgcaagcctctcctcacactgggcctggattacacaggcatctcctggaaggacaaggttgcagaccttcggttgaaaatggctgagaggaacgtcatgtggtttgtggtcactgccttggatgagattgcgtggctatttaatctccgaggatcagatgtggagcacaatccagtatttttctcctacgcaatcataggactagagacgatcatgctcttcattgatggtgaccgcatagacgcccccagtgtgaaggagcacctgcttcttgacttgggtctggaagccgaatacaggatccaggtgcatccctacaagtccatcctgagcgagctcaaggccctgtgtgctgacctctccccaagggagaaggtgtgggtcagtgacaaggccagctatgctgtgagcgagaccatccccaaggaccaccgctgctgtatgccttacacccccatctgcatcgccaaagctgtgaagaattcagctgagtcagaaggcatgaggcgggctcacattaaagatgctgttgctctctgtgaactctttaactggctggagaaagaggttcccaaaggtggtgtgacagagatctcagctgctgacaaagctgaggagtttcgcaggcaacaggcagactttgtggacctgagcttcccaacaatttccagtacgggacccaacggcgccatcattcactacgcgccagtccctgagacgaataggaccttgtccctggatgaggtgtaccttattgactcgggtgctcaatacaaggatggcaccacagatgtgacgcggacaatgcattttgggacccctacagcctacgagaaggaatgcttcacatatgtcctcaagggccacatagctgtgagtgcagccgttttcccgactggaaccaaaggtcaccttcttgactcctttgcccgttcagctttatgggattcaggcctagattacttgcacgggactggacatggtgttgggtcttttttgaatgtccatgagggtccttgcggcatcagttacaaaacattctctgatgagcccttggaggcaggcatgattgtcactgatgagcccgggtactatgaagatggggcttttggaattcgcattgagaatgttgtccttgtggttcctgtgaagaccaagtataattttaataaccggggaagcctgacctttgaacctctaacattggttccaattcagaccaaaatgatagatgtggattctcttacagacaaagagtgcgactggctcaacaattaccacctgacctgcagggatgtgattgggaaggaattgcagaaacagggccgccaggaagctctcgagtggctcatcagagagacgcaacccatctccaaacagcattaa

Sequence Length

1872

Vector

pENTR223.1

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

38197072

NCBI GeneID

7511

Molecular Weight

72,107 Da

NCBI Official Full Name

Homo sapiens X-prolyl aminopeptidase (aminopeptidase P) 1, soluble, mRNA

NCBI Official Synonym Full Names

X-prolyl aminopeptidase 1

NCBI Official Symbol

XPNPEP1

NCBI Official Synonym Symbols

APP1; SAMP; XPNPEP; XPNPEPL; XPNPEPL1

NCBI Protein Information

xaa-Pro aminopeptidase 1

UniProt Protein Name

Xaa-Pro aminopeptidase 1

UniProt Gene Name

XPNPEP1

UniProt Synonym Gene Names

sAmp

UniProt Entry Name

XPP1_HUMAN

NCBI Description

This gene encodes the cytosolic form of a metalloaminopeptidase that catalyzes the cleavage of the N-terminal amino acid adjacent to a proline residue. The gene product may play a role in degradation and maturation of tachykinins, neuropeptides, and peptide hormones. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Nov 2009]

Uniprot Description

XPNPEP1: Contributes to the degradation of bradykinin. Catalyzes the removal of a penultimate prolyl residue from the N-termini of peptides, such as Arg-Pro-Pro. Belongs to the peptidase M24B family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.4.11.9; Protease

Chromosomal Location of Human Ortholog: 10q25.3

Cellular Component: cytoplasm

Molecular Function: aminopeptidase activity; manganese ion binding; protein homodimerization activity

Biological Process: proteolysis

Research Articles on XPNPEP1

1. Observational study of gene-disease association, gene-gene interaction, gene-environment interaction, and pharmacogenomic / toxicogenomic. (HuGE Navigator)

Similar Products

Product Notes

The XPNPEP1 xpnpep1 (Catalog #AAA1271768) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctccaa aggtgacttc agagctgctt cggcagctga gacaagccat gaggaactct gagtatgtga ccgaaccgat ccaggcctac atcatcccat cgggagatgc tcatcagagt gagtatattg ctccatgtga ctgtcggcgg gcttttgtct ctggattcga tggctctgcg ggcacagcca tcatcacaga agagcatgca gccatgtgga ctgacgggcg ctactttctc caggctgcca agcaaatgga cagcaactgg acacttatga agatgggtct gaaggacaca ccaactcagg aagactggct ggtgagtgtg cttcctgaag gatccagggt tggtgtggac cccttgatca ttcctacaga ttattggaag aaaatggcca aagttctgag aagtgccggc catcacctca ttcctgtcaa ggagaacctc gttgacaaaa tctggacaga ccgtcctgag cgcccttgca agcctctcct cacactgggc ctggattaca caggcatctc ctggaaggac aaggttgcag accttcggtt gaaaatggct gagaggaacg tcatgtggtt tgtggtcact gccttggatg agattgcgtg gctatttaat ctccgaggat cagatgtgga gcacaatcca gtatttttct cctacgcaat cataggacta gagacgatca tgctcttcat tgatggtgac cgcatagacg cccccagtgt gaaggagcac ctgcttcttg acttgggtct ggaagccgaa tacaggatcc aggtgcatcc ctacaagtcc atcctgagcg agctcaaggc cctgtgtgct gacctctccc caagggagaa ggtgtgggtc agtgacaagg ccagctatgc tgtgagcgag accatcccca aggaccaccg ctgctgtatg ccttacaccc ccatctgcat cgccaaagct gtgaagaatt cagctgagtc agaaggcatg aggcgggctc acattaaaga tgctgttgct ctctgtgaac tctttaactg gctggagaaa gaggttccca aaggtggtgt gacagagatc tcagctgctg acaaagctga ggagtttcgc aggcaacagg cagactttgt ggacctgagc ttcccaacaa tttccagtac gggacccaac ggcgccatca ttcactacgc gccagtccct gagacgaata ggaccttgtc cctggatgag gtgtacctta ttgactcggg tgctcaatac aaggatggca ccacagatgt gacgcggaca atgcattttg ggacccctac agcctacgag aaggaatgct tcacatatgt cctcaagggc cacatagctg tgagtgcagc cgttttcccg actggaacca aaggtcacct tcttgactcc tttgcccgtt cagctttatg ggattcaggc ctagattact tgcacgggac tggacatggt gttgggtctt ttttgaatgt ccatgagggt ccttgcggca tcagttacaa aacattctct gatgagccct tggaggcagg catgattgtc actgatgagc ccgggtacta tgaagatggg gcttttggaa ttcgcattga gaatgttgtc cttgtggttc ctgtgaagac caagtataat tttaataacc ggggaagcct gacctttgaa cctctaacat tggttccaat tcagaccaaa atgatagatg tggattctct tacagacaaa gagtgcgact ggctcaacaa ttaccacctg acctgcaggg atgtgattgg gaaggaattg cagaaacagg gccgccagga agctctcgag tggctcatca gagagacgca acccatctcc aaacagcatt aa. It is sometimes possible for the material contained within the vial of "XPNPEP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

XPNPEP1 cdna clone