XKR6 cdna clone
XKR6 cDNA Clone
Gene Names
XKR6; XRG6; C8orf5; C8orf7; C8orf21
Synonyms
XKR6; XKR6 cDNA Clone; XKR6 cdna clone
Sequence
atgatgtatgaatatgcagacgtcaacatgctgcgcctcctggagaccttcctggagagcgcgccccaactggtgctacagctctacatcatgctccagaagaacagcgccgagaccctgccctgtgtctcctctgtgacttccctgatgtccctggcttgggtgctagcctcctatcacaagctgctgcgggactccagggacgacaagaagagcatgagctacagaggggccatcatccaggtcttctggcgcctcttcaccatctcatcccgagtgatctcttttgccctctttgcttccatcttccagctctattttgggatcttcgtggtggttcactggtgcgccatggccttctggatcatccatggcggaacagacttctgcatgtccaagtgggaggagatcctcttcaacatggtggtagggatcgtgtacattttctgctggtttaacgtcaaggaagggcggactcgatatcgaatgtttgcatattatacgatagtcttgaccgagaatgctgccttgacgttcctttggtatttttacagagacccggagaccactgactcctatgcggtgccagcactgtgttgtgtctttattagctttgtggctgggatcgcaatgatgctcttatactatggcgtgctgcatcccacaggaccacgagctaagatccttgccagctcctgttgtgccgagctgctctggggcatccctttgccccccgatgttgagcccatggcgcctgagatccctgggtaccgggggacccaggttacgcccaccagagccgtaacggaacaacaggaggatctcacggctgacacttgcttgcctgttttccaagtgagacccatggggccccctaccccgttggggcgtccttacctcccagaagggcccctcattaagattgacatgccaagaaagcgatacccagcttgggatgctcattttgtagacaggaggctgagaaggactattaacattctacaatatgtcacccccaccgcagtaggcattcgatatcgagacggaccactcctctatgagttgctacagtatgagtcttcactctaa
Sequence Length
1089
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
41,673 Da
NCBI Official Full Name
Homo sapiens XK, Kell blood group complex subunit-related family, member 6, mRNA
NCBI Official Synonym Full Names
XK related 6
NCBI Official Symbol
XKR6
NCBI Official Synonym Symbols
XRG6; C8orf5; C8orf7; C8orf21
NCBI Protein Information
XK-related protein 6
UniProt Protein Name
XK-related protein 6
Protein Family
UniProt Gene Name
XKR6
UniProt Synonym Gene Names
C8orf21; C8orf5; C8orf7; XRG6
UniProt Entry Name
XKR6_HUMAN
Uniprot Description
XKR6: Belongs to the XK family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, multi-pass; Membrane protein, integral
Chromosomal Location of Human Ortholog: 8p23.1
Cellular Component: membrane
Research Articles on XKR6
Similar Products
Product Notes
The XKR6 xkr6 (Catalog #AAA1276766) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgtatg aatatgcaga cgtcaacatg ctgcgcctcc tggagacctt cctggagagc gcgccccaac tggtgctaca gctctacatc atgctccaga agaacagcgc cgagaccctg ccctgtgtct cctctgtgac ttccctgatg tccctggctt gggtgctagc ctcctatcac aagctgctgc gggactccag ggacgacaag aagagcatga gctacagagg ggccatcatc caggtcttct ggcgcctctt caccatctca tcccgagtga tctcttttgc cctctttgct tccatcttcc agctctattt tgggatcttc gtggtggttc actggtgcgc catggccttc tggatcatcc atggcggaac agacttctgc atgtccaagt gggaggagat cctcttcaac atggtggtag ggatcgtgta cattttctgc tggtttaacg tcaaggaagg gcggactcga tatcgaatgt ttgcatatta tacgatagtc ttgaccgaga atgctgcctt gacgttcctt tggtattttt acagagaccc ggagaccact gactcctatg cggtgccagc actgtgttgt gtctttatta gctttgtggc tgggatcgca atgatgctct tatactatgg cgtgctgcat cccacaggac cacgagctaa gatccttgcc agctcctgtt gtgccgagct gctctggggc atccctttgc cccccgatgt tgagcccatg gcgcctgaga tccctgggta ccgggggacc caggttacgc ccaccagagc cgtaacggaa caacaggagg atctcacggc tgacacttgc ttgcctgttt tccaagtgag acccatgggg ccccctaccc cgttggggcg tccttacctc ccagaagggc ccctcattaa gattgacatg ccaagaaagc gatacccagc ttgggatgct cattttgtag acaggaggct gagaaggact attaacattc tacaatatgt cacccccacc gcagtaggca ttcgatatcg agacggacca ctcctctatg agttgctaca gtatgagtct tcactctaa. It is sometimes possible for the material contained within the vial of "XKR6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
