XK cdna clone
XK cDNA Clone
Gene Names
XK; KX; NA; NAC; X1k; XKR1
Synonyms
XK; XK cDNA Clone; XK cdna clone
Sequence
atgaaattcccggcctcggtgctggcgtccgtgttcctgttcgtggccgagacaacggcggcgctcagcctgagcagcacctaccgctcgggcggggaccgcatgtggcaggcgctgacgttgcttttctcgctactgccttgcgcgctcgtgcagctcacgcttctcttcgtacaccgcgacctcagccgcgaccgcccgctcgtactgctgctgcacctgctgcaacttgggccccttttcaggtgttttgaagtcttctgcatctactttcagtcaggcaacaatgaagagccttatgtcagtatcaccaagaagaggcaaatgccaaaaaatggcctctcagaggagattgagaaggaggtgggccaggcagaaggcaaactaatcacccaccgatcagcgttcagccgggcgtcggtgatccaggctttcttgggctcagccccccagctgaccctacagctgtacataagtgtcatgcagcaggacgtcactgttggaagaagtctcctcatgaccatatccctgttgtccattgtgtatggagccttgcgctgcaacatcctagccatcaaaatcaagtacgatgagtatgaagtcaaagtgaagcctctggcctatgtctgtatcttcctgtggaggagctttgagattgccactcgagttgtagtcctggtcctctttacctccgtcctgaagacctgggtggtggttataatactcatcaacttcttcagtttgttcttgtacccctggatcctcttctggtgcagtggttccccattccctgagaacatagagaaggccctcagtagagtgggcaccaccattgtactatgctttctaactttactctatactggtatcaacatgttctgctggtctgctgtacagctgaaaattgacagccctgacctcatcagcaagtcccataattggtaccagctactggtgtattacatgataagattcatcgagaatgccatcctcctcctcctgtggtatcttttcaagactgacatctatatgtatgtgtgcgcacctctgttggtcctgcagctgctcattgggtactgcacagccattctcttcatgcttgtattctatcagttcttccacccttgcaaaaagctcttttcttccagtgtttctgaaggctttcagaggtggctcaggtgtttttgctgggcctgcaggcagcaaaaaccctgtgagccgataggaaaggaagatctacagtcatccagagatagagatgagacaccttctagcagtaaaacaagtcctgagcctggtcagttcttgaatgctgaagatctctgctctgcttaa
Sequence Length
1335
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
50,902 Da
NCBI Official Full Name
Homo sapiens X-linked Kx blood group (McLeod syndrome), mRNA
NCBI Official Synonym Full Names
X-linked Kx blood group
NCBI Official Symbol
XK
NCBI Official Synonym Symbols
KX; NA; NAC; X1k; XKR1
NCBI Protein Information
membrane transport protein XK
UniProt Protein Name
Membrane transport protein XK
Protein Family
UniProt Gene Name
XK
UniProt Synonym Gene Names
XKR1; XRG1
UniProt Entry Name
XK_HUMAN
NCBI Description
This locus controls the synthesis of the Kell blood group 'precursor substance' (Kx). Mutations in this gene have been associated with McLeod syndrome, an X-linked, recessive disorder characterized by abnormalities in the neuromuscular and hematopoietic systems. The encoded protein has structural characteristics of prokaryotic and eukaryotic membrane transport proteins. [provided by RefSeq, Jul 2008]
Uniprot Description
XK: May be involved in sodium-dependent transport of neutral amino acids or oligopeptides. Defects in XK are the cause of McLeod syndrome (MLS). It is an X-linked multisystem disorder characterized by late onset abnormalities in the neuromuscular and hematopoietic systems. Belongs to the XK family.
Protein type: Membrane protein, multi-pass; Membrane protein, integral; Cell surface
Chromosomal Location of Human Ortholog: Xp21.1
Cellular Component: integral to membrane; plasma membrane
Molecular Function: protein binding; transporter activity
Biological Process: transport
Disease: Mcleod Syndrome
Research Articles on XK
Similar Products
Product Notes
The XK xk (Catalog #AAA1275439) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaattcc cggcctcggt gctggcgtcc gtgttcctgt tcgtggccga gacaacggcg gcgctcagcc tgagcagcac ctaccgctcg ggcggggacc gcatgtggca ggcgctgacg ttgcttttct cgctactgcc ttgcgcgctc gtgcagctca cgcttctctt cgtacaccgc gacctcagcc gcgaccgccc gctcgtactg ctgctgcacc tgctgcaact tgggcccctt ttcaggtgtt ttgaagtctt ctgcatctac tttcagtcag gcaacaatga agagccttat gtcagtatca ccaagaagag gcaaatgcca aaaaatggcc tctcagagga gattgagaag gaggtgggcc aggcagaagg caaactaatc acccaccgat cagcgttcag ccgggcgtcg gtgatccagg ctttcttggg ctcagccccc cagctgaccc tacagctgta cataagtgtc atgcagcagg acgtcactgt tggaagaagt ctcctcatga ccatatccct gttgtccatt gtgtatggag ccttgcgctg caacatccta gccatcaaaa tcaagtacga tgagtatgaa gtcaaagtga agcctctggc ctatgtctgt atcttcctgt ggaggagctt tgagattgcc actcgagttg tagtcctggt cctctttacc tccgtcctga agacctgggt ggtggttata atactcatca acttcttcag tttgttcttg tacccctgga tcctcttctg gtgcagtggt tccccattcc ctgagaacat agagaaggcc ctcagtagag tgggcaccac cattgtacta tgctttctaa ctttactcta tactggtatc aacatgttct gctggtctgc tgtacagctg aaaattgaca gccctgacct catcagcaag tcccataatt ggtaccagct actggtgtat tacatgataa gattcatcga gaatgccatc ctcctcctcc tgtggtatct tttcaagact gacatctata tgtatgtgtg cgcacctctg ttggtcctgc agctgctcat tgggtactgc acagccattc tcttcatgct tgtattctat cagttcttcc acccttgcaa aaagctcttt tcttccagtg tttctgaagg ctttcagagg tggctcaggt gtttttgctg ggcctgcagg cagcaaaaac cctgtgagcc gataggaaag gaagatctac agtcatccag agatagagat gagacacctt ctagcagtaa aacaagtcct gagcctggtc agttcttgaa tgctgaagat ctctgctctg cttaa. It is sometimes possible for the material contained within the vial of "XK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
