Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

XIAP cdna clone

XIAP cDNA Clone

Gene Names
XIAP; API3; ILP1; MIHA; XLP2; BIRC4; IAP-3; hIAP3; hIAP-3
Synonyms
XIAP; XIAP cDNA Clone; XIAP cdna clone
Ordering
For Research Use Only!
Sequence
atgacttttaacagttttgaaggatctaaaacttgtgtacctgcagacatcaataaggaagaagaatttgtagaagagtttaatagattaaaaacttttgctaattttccaagtggtagtcctgtttcagcatcaacactggcacgagcagggtttctttatactggtgaaggagataccgtgcggtgctttagttgtcatgcagctgtagatagatggcaatatggagactcagcagttggaagacacaggaaagtatccccaaattgcagatttatcaacggcttttatcttgaaaatagtgccacgcagtctacaaattctggtatccagaatggtcagtacaaagttgaaaactatctgggaagcagagatcattttgccttagacaggccatctgagacacatgcagactatcttttgagaactgggcaggttgtagatatatcagacaccatatacccgaggaaccctgccatgtatagtgaagaagctagattaaagtcctttcagaactggccagactatgctcacctaaccccaagagagttagcaagtgctggactctactacacaggtattggtgaccaagtgcagtgcttttgttgtggtggaaaactgaaaaattgggaaccttgtgatcgtgcctggtcagaacacaggcgacactttcctaattgcttctttgttttgggccggaatcttaatattcgaagtgaatctgatgctgtgagttctgataggaatttcccaaattcaacaaatcttccaagaaatccatccatggcagattatgaagcacggatctttacttttgggacatggatatactcagttaacaaggagcagcttgcaagagctggattttatgctttaggtgaaggtgataaagtaaagtgctttcactgtggaggagggctaactgattggaagcccagtgaagacccttgggaacaacatgctaaatggtatccagggtgcaaatatctgttagaacagaagggacaagaatatataaacaatattcatttaactcattcacttgaggagtgtctggtaagaactactgagaaaacaccatcactaactagaagaattgatgataccatcttccaaaatcctatggtacaagaagctatacgaatggggttcagtttcaaggacattaagaaaataatggaggaaaaaattcagatatctgggagcaactataaatcacttgaggttctggttgcagatctagtgaatgctcagaaagacagtatgcaagatgagtcaagtcagacttcattacagaaagagattagtactgaagagcagctaaggcgcctgcaagaggagaagctttgcaaaatctgtatggatagaaatattgctatcgtttttgttccttgtggacatctagtcacttgtaaacaatgtgctgaagcagttgacaagtgtcccatgtgctacacagtcattactttcaagcaaaaaatttttatgtcttaa
Sequence Length
1494
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
331
Molecular Weight
56,685 Da
NCBI Official Full Name
Homo sapiens X-linked inhibitor of apoptosis, mRNA
NCBI Official Synonym Full Names
X-linked inhibitor of apoptosis
NCBI Official Symbol
XIAP
NCBI Official Synonym Symbols
API3; ILP1; MIHA; XLP2; BIRC4; IAP-3; hIAP3; hIAP-3
NCBI Protein Information
E3 ubiquitin-protein ligase XIAP
UniProt Protein Name
E3 ubiquitin-protein ligase XIAP
Protein Family
UniProt Gene Name
XIAP
UniProt Synonym Gene Names
API3; BIRC4; IAP3; ILP; hILP; IAP-3; hIAP-3; hIAP3; X-linked IAP
UniProt Entry Name
XIAP_HUMAN

NCBI Description

This gene encodes a protein that belongs to a family of apoptotic suppressor proteins. Members of this family share a conserved motif termed, baculovirus IAP repeat, which is necessary for their anti-apoptotic function. This protein functions through binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2 and inhibits apoptosis induced by menadione, a potent inducer of free radicals, and interleukin 1-beta converting enzyme. This protein also inhibits at least two members of the caspase family of cell-death proteases, caspase-3 and caspase-7. Mutations in this gene are the cause of X-linked lymphoproliferative syndrome. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 2 and 11.[provided by RefSeq, Feb 2011]

Uniprot Description

XIAP: an apoptotic suppressor protein. Inhibist apoptosis through binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2. Inhibits apoptosis induced by menadione, a potent inducer of free radicals, and ICE. Inhibits cell-death proteases, caspase-3, caspase-7, and perhaps caspase-9.

Protein type: Apoptosis; EC 6.3.2.-; Ligase; Ubiquitin conjugating system; Ubiquitin ligase

Chromosomal Location of Human Ortholog: Xq25

Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus; spindle microtubule

Molecular Function: caspase inhibitor activity; identical protein binding; protein binding; ubiquitin-protein ligase activity

Biological Process: copper ion homeostasis; negative regulation of apoptosis; negative regulation of caspase activity; positive regulation of protein ubiquitination; regulation of BMP signaling pathway; regulation of cell proliferation; regulation of inflammatory response; regulation of innate immune response; response to DNA damage stimulus

Disease: Lymphoproliferative Syndrome, X-linked, 1; Lymphoproliferative Syndrome, X-linked, 2

Research Articles on XIAP

Similar Products

Product Notes

The XIAP xiap (Catalog #AAA1276275) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactttta acagttttga aggatctaaa acttgtgtac ctgcagacat caataaggaa gaagaatttg tagaagagtt taatagatta aaaacttttg ctaattttcc aagtggtagt cctgtttcag catcaacact ggcacgagca gggtttcttt atactggtga aggagatacc gtgcggtgct ttagttgtca tgcagctgta gatagatggc aatatggaga ctcagcagtt ggaagacaca ggaaagtatc cccaaattgc agatttatca acggctttta tcttgaaaat agtgccacgc agtctacaaa ttctggtatc cagaatggtc agtacaaagt tgaaaactat ctgggaagca gagatcattt tgccttagac aggccatctg agacacatgc agactatctt ttgagaactg ggcaggttgt agatatatca gacaccatat acccgaggaa ccctgccatg tatagtgaag aagctagatt aaagtccttt cagaactggc cagactatgc tcacctaacc ccaagagagt tagcaagtgc tggactctac tacacaggta ttggtgacca agtgcagtgc ttttgttgtg gtggaaaact gaaaaattgg gaaccttgtg atcgtgcctg gtcagaacac aggcgacact ttcctaattg cttctttgtt ttgggccgga atcttaatat tcgaagtgaa tctgatgctg tgagttctga taggaatttc ccaaattcaa caaatcttcc aagaaatcca tccatggcag attatgaagc acggatcttt acttttggga catggatata ctcagttaac aaggagcagc ttgcaagagc tggattttat gctttaggtg aaggtgataa agtaaagtgc tttcactgtg gaggagggct aactgattgg aagcccagtg aagacccttg ggaacaacat gctaaatggt atccagggtg caaatatctg ttagaacaga agggacaaga atatataaac aatattcatt taactcattc acttgaggag tgtctggtaa gaactactga gaaaacacca tcactaacta gaagaattga tgataccatc ttccaaaatc ctatggtaca agaagctata cgaatggggt tcagtttcaa ggacattaag aaaataatgg aggaaaaaat tcagatatct gggagcaact ataaatcact tgaggttctg gttgcagatc tagtgaatgc tcagaaagac agtatgcaag atgagtcaag tcagacttca ttacagaaag agattagtac tgaagagcag ctaaggcgcc tgcaagagga gaagctttgc aaaatctgta tggatagaaa tattgctatc gtttttgttc cttgtggaca tctagtcact tgtaaacaat gtgctgaagc agttgacaag tgtcccatgt gctacacagt cattactttc aagcaaaaaa tttttatgtc ttaa. It is sometimes possible for the material contained within the vial of "XIAP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.