Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WNT4 cdna clone

WNT4 cDNA Clone

Gene Names
WNT4; WNT-4; SERKAL
Synonyms
WNT4; WNT4 cDNA Clone; WNT4 cdna clone
Ordering
For Research Use Only!
Sequence
atgagtccccgctcgtgcctgcgttcgctgcgcctcctcgtcttcgccgtcttctcagccgccgcgagcaactggctgtacctggccaagctgtcgtcggtggggagcatctcagaggaggagacgtgcgagaaactcaagggcctgatccagaggcaggtgcagatgtgcaagcggaacctggaagtcatggactcggtgcgccgcggtgcccagctggccattgaggagtgccagtaccagttccggaaccggcgctggaactgctccacactcgactccttgcccgtcttcggcaaggtggtgacgcaagggactcgggaggcggccttcgtgtacgccatctcttcggcaggtgtggcctttgcagtgacgcgggcgtgcagcagtggggagctggagaagtgcggctgtgacaggacagtgcatggggtcagcccacagggcttccagtggtcaggatgctctgacaacatcgcctacggtgtggctttctcacagtcgtttgtggatgtgcgggagagaagcaagggggcctcgtccagcagagccctcatgaacctccacaacaatgaggccggcaggaaggccatcctgacacacatgcgggtggaatgcaagtgccacggggtgtcaggctcctgtgaggtaaagacgtgctggcgagccgtgccgcccttccgccaggtgggtcacgcactgaaggagaagtttgatggtgccactgaggtggagccacgccgcgtgggctcctccagggcactggtgccacgcaacgcacagttcaagccgcacacagatgaggacctggtgtacttggagcctagccccgacttctgtgagcaggacatgcgcagcggcgtgctgggcacgaggggccgcacatgcaacaagacgtccaaggccatcgacggctgtgagctgctgtgctgtggccgcggcttccacacggcgcaggtggagctggctgaacgctgcagctgcaaattccactggtgctgcttcgtcaagtgccggcagtgccagcggctcgtggagttgcacacgtgccgatga
Sequence Length
1056
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,954 Da
NCBI Official Full Name
Homo sapiens wingless-type MMTV integration site family, member 4, mRNA
NCBI Official Synonym Full Names
Wnt family member 4
NCBI Official Symbol
WNT4
NCBI Official Synonym Symbols
WNT-4; SERKAL
NCBI Protein Information
protein Wnt-4
UniProt Protein Name
Protein Wnt-4
UniProt Gene Name
WNT4
UniProt Entry Name
WNT4_HUMAN

NCBI Description

The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family, and is the first signaling molecule shown to influence the sex-determination cascade. It encodes a protein which shows 98% amino acid identity to the Wnt4 protein of mouse and rat. This gene and a nuclear receptor known to antagonize the testis-determining factor play a concerted role in both the control of female development and the prevention of testes formation. This gene and another two family members, WNT2 and WNT7B, may be associated with abnormal proliferation in breast tissue. Mutations in this gene can result in Rokitansky-Kuster-Hauser syndrome and in SERKAL syndrome. [provided by RefSeq, Jul 2008]

Uniprot Description

WNT4: Ligand for members of the frizzled family of seven transmembrane receptors. Probable developmental protein. May be a signaling molecule which affects the development of discrete regions of tissues. Is likely to signal over only few cell diameters. Overexpression may be associated with abnormal proliferation in human breast tissue. Defects in WNT4 are a cause of Rokitansky-Kuster-Hauser syndrome (RKH syndrome); also called Mayer- Rokitansky-Kuster-Hauser syndrome (MRKH syndrome or MRKH anomaly). RKH syndrome is characterized by utero-vaginal atresia in otherwise phenotypically normal female with a normal 46,XX karyotype. Anomalies of the genital tract range from upper vaginal atresia to total Muellerian agenesis with urinary tract abnormalities. It has an incidence of approximately 1 in 5'000 newborn girls. Defects in WNT4 are the cause of female sex reversal with dysgenesis of kidneys, adrenals, and lungs (SERKAL); also known as SERKAL syndrome. Defects in WNT4 are the cause of Muellerian aplasia (MULLAPL). Belongs to the Wnt family.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 1p36.23-p35.1

Cellular Component: cell surface; cytoplasm; endoplasmic reticulum lumen; extracellular region; extracellular space; Golgi lumen; plasma membrane

Molecular Function: frizzled binding; receptor agonist activity; transcription corepressor activity

Biological Process: adrenal gland development; androgen biosynthetic process; cell fate commitment; epithelial to mesenchymal transition; female gonad development; female sex determination; kidney development; liver development; male gonad development; negative regulation of transcription, DNA-dependent; neuron differentiation; positive regulation of aldosterone biosynthetic process; positive regulation of bone mineralization; positive regulation of collagen biosynthetic process; positive regulation of osteoblast differentiation; positive regulation of transcription, DNA-dependent; Wnt receptor signaling pathway; Wnt receptor signaling pathway through beta-catenin

Disease: 46,xx Sex Reversal With Dysgenesis Of Kidneys, Adrenals, And Lungs; Mullerian Aplasia And Hyperandrogenism

Research Articles on WNT4

Similar Products

Product Notes

The WNT4 wnt4 (Catalog #AAA1278002) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtcccc gctcgtgcct gcgttcgctg cgcctcctcg tcttcgccgt cttctcagcc gccgcgagca actggctgta cctggccaag ctgtcgtcgg tggggagcat ctcagaggag gagacgtgcg agaaactcaa gggcctgatc cagaggcagg tgcagatgtg caagcggaac ctggaagtca tggactcggt gcgccgcggt gcccagctgg ccattgagga gtgccagtac cagttccgga accggcgctg gaactgctcc acactcgact ccttgcccgt cttcggcaag gtggtgacgc aagggactcg ggaggcggcc ttcgtgtacg ccatctcttc ggcaggtgtg gcctttgcag tgacgcgggc gtgcagcagt ggggagctgg agaagtgcgg ctgtgacagg acagtgcatg gggtcagccc acagggcttc cagtggtcag gatgctctga caacatcgcc tacggtgtgg ctttctcaca gtcgtttgtg gatgtgcggg agagaagcaa gggggcctcg tccagcagag ccctcatgaa cctccacaac aatgaggccg gcaggaaggc catcctgaca cacatgcggg tggaatgcaa gtgccacggg gtgtcaggct cctgtgaggt aaagacgtgc tggcgagccg tgccgccctt ccgccaggtg ggtcacgcac tgaaggagaa gtttgatggt gccactgagg tggagccacg ccgcgtgggc tcctccaggg cactggtgcc acgcaacgca cagttcaagc cgcacacaga tgaggacctg gtgtacttgg agcctagccc cgacttctgt gagcaggaca tgcgcagcgg cgtgctgggc acgaggggcc gcacatgcaa caagacgtcc aaggccatcg acggctgtga gctgctgtgc tgtggccgcg gcttccacac ggcgcaggtg gagctggctg aacgctgcag ctgcaaattc cactggtgct gcttcgtcaa gtgccggcag tgccagcggc tcgtggagtt gcacacgtgc cgatga. It is sometimes possible for the material contained within the vial of "WNT4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.