WIF1 cdna clone
WIF1 cDNA Clone
Gene Names
WIF1; WIF-1
Synonyms
WIF1; WIF1 cDNA Clone; WIF1 cdna clone
Sequence
atggcccggaggagcgccttccctgccgccgcgctctggctctggagcatcctcctgtgcctgctggcactgcgggcggaggccgggccgccgcaggaggagagcctgtacctatggatcgatgctcaccaggcaagagtactcataggatttgaagaagatatcctgattgtttcggaggggaaaatggcaccttttacacatgatttcagaaaagcgcaacagagaatgccagctattcctgtcaatatccattccatgaattttacctggcaagctgcagggcaggcagaatacttctatgaattcctgtccttgcgctccctggataaaggcatcatggcagatccaaccgtcaatgtccctctgctgggaacagtgcctcacaaggcatcagttgttcaagttggtttcccatgtcttggaaaacaggatggggtggcagcatttgaagtggatgtgattgttatgaattctgaaggcaacaccattctcaaaacacctcaaaatgctatcttctttaaaacatgtcaacaagctgagtgcccaggcgggtgccgaaatggaggcttttgtaatgaaagacgcatctgcgagtgtcctgatgggttccacggacctcactgtgagaaagccctttgtaccccacgatgtatgaatggtggactttgtgtgactcctggtttctgcatctgcccacctggattctatggagtgaactgtgacaaagcaaactgctcaaccacctgctttaatggagggacctgtttctaccctggaaaatgtatttgccctccaggactagagggagagcagtgtgaaatcagcaaatgcccacaaccctgtcgaaatggaggtaaatgcattggtaaaagcaaatgtaagtgttccaaaggttaccagggagacctctgttcaaagcctgtctgcgagcctggctgtggtgcacatggaacctgccatgaacccaacaaatgccaatgtcaagaaggttggcatggaagacactgcaataaaaggtacgaagccagcctcatacatgccctgaggccagcaggcgcccagctcaggcagcacacgccttcacttaaaaaggccgaggagcggcgggatccacctgaatccaattacatctggtga
Sequence Length
1140
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
41,528 Da
NCBI Official Full Name
Homo sapiens WNT inhibitory factor 1, mRNA
NCBI Official Synonym Full Names
WNT inhibitory factor 1
NCBI Official Symbol
WIF1
NCBI Official Synonym Symbols
WIF-1
NCBI Protein Information
wnt inhibitory factor 1
UniProt Protein Name
Wnt inhibitory factor 1
Protein Family
UniProt Gene Name
WIF1
UniProt Synonym Gene Names
WIF-1
UniProt Entry Name
WIF1_HUMAN
NCBI Description
The protein encoded by this gene functions to inhibit WNT proteins, which are extracellular signaling molecules that play a role in embryonic development. This protein contains a WNT inhibitory factor (WIF) domain and five epidermal growth factor (EGF)-like domains, and is thought to be involved in mesoderm segmentation. This gene functions as a tumor suppressor gene, and has been found to be epigenetically silenced in various cancers. [provided by RefSeq, Jun 2010]
Uniprot Description
WIF1: Binds to WNT proteins and inhibits their activities. May be involved in mesoderm segmentation.
Protein type: Secreted, signal peptide; Secreted; Inhibitor
Chromosomal Location of Human Ortholog: 12q14.3
Molecular Function: protein binding
Research Articles on WIF1
Similar Products
Product Notes
The WIF1 wif1 (Catalog #AAA1269192) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccgga ggagcgcctt ccctgccgcc gcgctctggc tctggagcat cctcctgtgc ctgctggcac tgcgggcgga ggccgggccg ccgcaggagg agagcctgta cctatggatc gatgctcacc aggcaagagt actcatagga tttgaagaag atatcctgat tgtttcggag gggaaaatgg caccttttac acatgatttc agaaaagcgc aacagagaat gccagctatt cctgtcaata tccattccat gaattttacc tggcaagctg cagggcaggc agaatacttc tatgaattcc tgtccttgcg ctccctggat aaaggcatca tggcagatcc aaccgtcaat gtccctctgc tgggaacagt gcctcacaag gcatcagttg ttcaagttgg tttcccatgt cttggaaaac aggatggggt ggcagcattt gaagtggatg tgattgttat gaattctgaa ggcaacacca ttctcaaaac acctcaaaat gctatcttct ttaaaacatg tcaacaagct gagtgcccag gcgggtgccg aaatggaggc ttttgtaatg aaagacgcat ctgcgagtgt cctgatgggt tccacggacc tcactgtgag aaagcccttt gtaccccacg atgtatgaat ggtggacttt gtgtgactcc tggtttctgc atctgcccac ctggattcta tggagtgaac tgtgacaaag caaactgctc aaccacctgc tttaatggag ggacctgttt ctaccctgga aaatgtattt gccctccagg actagaggga gagcagtgtg aaatcagcaa atgcccacaa ccctgtcgaa atggaggtaa atgcattggt aaaagcaaat gtaagtgttc caaaggttac cagggagacc tctgttcaaa gcctgtctgc gagcctggct gtggtgcaca tggaacctgc catgaaccca acaaatgcca atgtcaagaa ggttggcatg gaagacactg caataaaagg tacgaagcca gcctcataca tgccctgagg ccagcaggcg cccagctcag gcagcacacg ccttcactta aaaaggccga ggagcggcgg gatccacctg aatccaatta catctggtga. It is sometimes possible for the material contained within the vial of "WIF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
