Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WIBG cdna clone

WIBG cDNA Clone

Gene Names
PYM1; PYM; WIBG
Synonyms
WIBG; WIBG cDNA Clone; WIBG cdna clone
Ordering
For Research Use Only!
Sequence
atggaagctgccggcagccctgcggctacggagacaggcaagtatatcgcgtcaacacagcgacctgacgggacctggcgcaagcagcggagggtgaaagaaggatatgtgccccaggaggaggtcccagtatatgaaaacaagtatgtgaagtttttcaagagtaaaccagagttgcccccagggctaagccctgaggccactgctcctgtcaccccatccaggcctgaaggtggtgaaccaggcctctccaagacagccaaacgtaacctgaagcgaaaggagaagaggcggcagcagcaagagaaaggagaggcagaggccttgagcaggactcttgataaggtgtccctggaagagacagcccaactccccagtgctccacagggctctcgggcagcccccacagctgcatctgaccagcctgactcagctgccaccactgagaaagccaagaagataaagaacctaaagaagaaactccggcaggtggaagagctgcagcagcggatccaggctggggaagtcagccagcccagcaaagagcagctagaaaagctagcaaggaggagggcgctagaagaggagttagaggacttggagttaggcctctga
Sequence Length
615
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,705 Da
NCBI Official Full Name
Homo sapiens within bgcn homolog (Drosophila), mRNA
NCBI Official Synonym Full Names
PYM homolog 1, exon junction complex associated factor
NCBI Official Symbol
PYM1
NCBI Official Synonym Symbols
PYM; WIBG
NCBI Protein Information
partner of Y14 and mago
UniProt Protein Name
Partner of Y14 and mago
UniProt Gene Name
PYM1
UniProt Entry Name
PYM1_HUMAN

Uniprot Description

WIBG: a conserved protein of unknown function. A potential RNA-binding protein.

Protein type: Translation; RNA-binding; Nucleolus

Chromosomal Location of Human Ortholog: 12q13.2

Molecular Function: protein binding; ribosome binding

Biological Process: mRNA catabolic process, nonsense-mediated decay; positive regulation of translation

Research Articles on WIBG

Similar Products

Product Notes

The WIBG pym1 (Catalog #AAA1267461) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagctg ccggcagccc tgcggctacg gagacaggca agtatatcgc gtcaacacag cgacctgacg ggacctggcg caagcagcgg agggtgaaag aaggatatgt gccccaggag gaggtcccag tatatgaaaa caagtatgtg aagtttttca agagtaaacc agagttgccc ccagggctaa gccctgaggc cactgctcct gtcaccccat ccaggcctga aggtggtgaa ccaggcctct ccaagacagc caaacgtaac ctgaagcgaa aggagaagag gcggcagcag caagagaaag gagaggcaga ggccttgagc aggactcttg ataaggtgtc cctggaagag acagcccaac tccccagtgc tccacagggc tctcgggcag cccccacagc tgcatctgac cagcctgact cagctgccac cactgagaaa gccaagaaga taaagaacct aaagaagaaa ctccggcagg tggaagagct gcagcagcgg atccaggctg gggaagtcag ccagcccagc aaagagcagc tagaaaagct agcaaggagg agggcgctag aagaggagtt agaggacttg gagttaggcc tctga. It is sometimes possible for the material contained within the vial of "WIBG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.