Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WFDC2 cdna clone

WFDC2 cDNA Clone

Gene Names
WFDC2; HE4; WAP5; EDDM4; dJ461P17.6
Synonyms
WFDC2; WFDC2 cDNA Clone; WFDC2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcctgcttgtcgcctaggcccgctagccgccgccctcctcctcagcctgctgctgttcggcttcaccctagtctcaggcacaggagcagagaagactggcgtgtgccccgagctccaggctgaccagaactgcacgcaagagtgcgtctcggacagcgaatgcgccgacaacctcaagtgctgcagcgcgggctgtgccaccttctgctctctgcccaatgataaggagggttcctgcccccaggtgaacattaactttccccagctcggcctctgtcgggaccagtgccaggtggacagccagtgtcctggccagatgaaatgctgccgcaatggctgtgggaaggtgtcctgtgtcactcccaatttctga
Sequence Length
375
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
11,043 Da
NCBI Official Full Name
Homo sapiens WAP four-disulfide core domain 2, mRNA
NCBI Official Synonym Full Names
WAP four-disulfide core domain 2
NCBI Official Symbol
WFDC2
NCBI Official Synonym Symbols
HE4; WAP5; EDDM4; dJ461P17.6
NCBI Protein Information
WAP four-disulfide core domain protein 2
UniProt Protein Name
WAP four-disulfide core domain protein 2
UniProt Gene Name
WFDC2
UniProt Synonym Gene Names
HE4; WAP5
UniProt Entry Name
WFDC2_HUMAN

NCBI Description

This gene encodes a protein that is a member of the WFDC domain family. The WFDC domain, or WAP Signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor in many family members. This gene is expressed in pulmonary epithelial cells, and was also found to be expressed in some ovarian cancers. The encoded protein is a small secretory protein, which may be involved in sperm maturation. [provided by RefSeq, Jul 2008]

Uniprot Description

WFDC2: a protein that is a member of the WFDC domain family. The WFDC domain, or WAP Signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor in many family members. This gene is expressed in pulmonary epithelial cells, and was also found to be expressed in some ovarian cancers. The encoded protein is a small secretory protein, which may be involved in sperm maturation. [provided by RefSeq, Jul 2008]

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 20q13.12

Cellular Component: extracellular space

Molecular Function: aspartic-type endopeptidase inhibitor activity; endopeptidase inhibitor activity; serine-type endopeptidase inhibitor activity

Biological Process: proteolysis; spermatogenesis

Research Articles on WFDC2

Similar Products

Product Notes

The WFDC2 wfdc2 (Catalog #AAA1266437) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctgctt gtcgcctagg cccgctagcc gccgccctcc tcctcagcct gctgctgttc ggcttcaccc tagtctcagg cacaggagca gagaagactg gcgtgtgccc cgagctccag gctgaccaga actgcacgca agagtgcgtc tcggacagcg aatgcgccga caacctcaag tgctgcagcg cgggctgtgc caccttctgc tctctgccca atgataagga gggttcctgc ccccaggtga acattaactt tccccagctc ggcctctgtc gggaccagtg ccaggtggac agccagtgtc ctggccagat gaaatgctgc cgcaatggct gtgggaaggt gtcctgtgtc actcccaatt tctga. It is sometimes possible for the material contained within the vial of "WFDC2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.