Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

WDR76 cdna clone

WDR76 cDNA Clone

Gene Names
WDR76; CDW14
Synonyms
WDR76; WDR76 cDNA Clone; WDR76 cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atgtccaggtcgggcgcggcggctgagaaggcggactccagacagcgaccccagatgaaggtaaatgaatataaagaaaatcaaaacatcgcttatgtgtctctgagaccagcacagactacagttttaataaaaacagctaaggtctatcttgcccccttttcactcagtaattaccagctagaccagcttatgtgccccaaatccctatcagaaaagaattctaacaatgaagtggcgtgtaagaagactaaaataaagaaaacttgcagaaggattatacctccaaagatgaaaaacacatcttccaaggcagaatccacgctgcaaaattcatcctcagctgttcatactgaaagtaacaagctacaacccaagagaacggcagatgcgatgaatctcagtgttgatgtggaaagtagtcaggatggagacagtgatgaagataccacaccagccctggatttttcgggattgtcaccctacgaaaggaagagactgaagaacatatcagaaaacgcagacttttttgcttctcttcagttgtctgagtctgctgcaagactccgtgaaatgatagagaagagacagcctcctaaatccaaaagaaagaagcctaagagagaaaatgggattggatgtagaaggtcaatgcgattactaaaagttgatccttcgggagtttcattaccagcagctccaacaccgccgacattagtagcagatgaaactcctttgttacctcctgggcctttagaaatgacttctgaaaatcaagaagacaacaatgaacgatttaaaggatttctgcacacatgggcaggaatgagcaagccaagtagtaagaacactgagaagggattatctagcattaaaagctacaaagccaatttaaatggcatggtcattagtgaagataccgtttacaaagttaccacaggcccaatattctctatggctctccatccatcagaaactagaactttggtagcagttggggccaaatttgggcaagttggactttgtgatttgacccagcaacctaaagaagatggagtttatgtttttcatccccatagtcagccagttagctgtctttacttctcacccgccaatccggcccacatactgtcactgagctatgatggcacgttacgctgtggggatttttccagggctatttttgaagaggtgtatagaaatgaaagaagtagcttttcctccttcgacttcttggcagaagatgcctccactttaatagtaggacactgggatggaaatatgtcactggtggatagacggacacctggaacttcttatgagaaacttaccagttcttctatgggaaaaataagaactgttcatgtccacccagtgcatagacagtattttatcactgccggattgagggatactcatatttatgatgcaaggcgattgaattccaggagaagtcagcctttgatttctttgactgaacatacaaagagcattgcttccgcctatttttcacctcttactggtaacagagtggtgaccacatgtgctgattgtaatctgagaatttttgacagcagctgtatatcttctaagattccgctcctcaccaccatcaggcacaacactttcactgggcgatggctgaccaggttccaagccatgtgggatcctaaacaagaagactgtgtcatagttggcagcatggcccatccacgacgggtagaaatcttccatgagacaggaaagagggtgcattcgtttggtggagaataccttgtctctgtgtgttccatcaatgccatgcacccaactcggtatattttggctggaggtaattccagcgggaagatacatgtttttatgaatgaaaaaagctgctga
Sequence Length
1881
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
69,769 Da
NCBI Official Full Name
Homo sapiens WD repeat domain 76, mRNA
NCBI Official Synonym Full Names
WD repeat domain 76
NCBI Official Symbol
WDR76
NCBI Official Synonym Symbols
CDW14
NCBI Protein Information
WD repeat-containing protein 76
UniProt Protein Name
WD repeat-containing protein 76
Protein Family
UniProt Gene Name
WDR76
UniProt Entry Name
WDR76_HUMAN

Uniprot Description

WDR76: Belongs to the WD repeat DDB2/WDR76 family.

Chromosomal Location of Human Ortholog: 15q15.3

Research Articles on WDR76

1. Observational study of gene-disease association, gene-environment interaction, and pharmacogenomic / toxicogenomic. (HuGE Navigator)

Similar Products

WDR76 Antibody

Host: Rabbit
Reactivity: Human
Apps: ELISA, Western Blot, Immunofluorescence

WDR76 Antibody

Host: Rabbit
Reactivity: Human, Mouse
Apps: ELISA, Western Blot

WDR76 Antibody

Host: Rabbit
Reactivity: Human, Mouse
Apps: Western Blot, ELISA

WDR76 Antibody

Host: Rabbit
Reactivity: Human, Mouse
Apps: Western Blot, ELISA

WDR76 Antibody

Host: Rabbit
Reactivity: Human, Mouse
Apps: Western Blot, ELISA

WDR76 Antibody

Host: Rabbit
Reactivity: Human, Mouse
Apps: Western Blot

WDR76 Antibody

Host: Rabbit
Reactivity: Human, Mouse
Apps: Western Blot

WDR76 Antibody

Host: Rabbit
Reactivity: Human, Mouse
Apps: Western Blot

WDR76 Antibody

Host: Rabbit
Reactivity: Human, mouse
Apps: Western Blot, ELISA

Product Notes

The WDR76 wdr76 (Catalog #AAA1267434) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccaggt cgggcgcggc ggctgagaag gcggactcca gacagcgacc ccagatgaag gtaaatgaat ataaagaaaa tcaaaacatc gcttatgtgt ctctgagacc agcacagact acagttttaa taaaaacagc taaggtctat cttgccccct tttcactcag taattaccag ctagaccagc ttatgtgccc caaatcccta tcagaaaaga attctaacaa tgaagtggcg tgtaagaaga ctaaaataaa gaaaacttgc agaaggatta tacctccaaa gatgaaaaac acatcttcca aggcagaatc cacgctgcaa aattcatcct cagctgttca tactgaaagt aacaagctac aacccaagag aacggcagat gcgatgaatc tcagtgttga tgtggaaagt agtcaggatg gagacagtga tgaagatacc acaccagccc tggatttttc gggattgtca ccctacgaaa ggaagagact gaagaacata tcagaaaacg cagacttttt tgcttctctt cagttgtctg agtctgctgc aagactccgt gaaatgatag agaagagaca gcctcctaaa tccaaaagaa agaagcctaa gagagaaaat gggattggat gtagaaggtc aatgcgatta ctaaaagttg atccttcggg agtttcatta ccagcagctc caacaccgcc gacattagta gcagatgaaa ctcctttgtt acctcctggg cctttagaaa tgacttctga aaatcaagaa gacaacaatg aacgatttaa aggatttctg cacacatggg caggaatgag caagccaagt agtaagaaca ctgagaaggg attatctagc attaaaagct acaaagccaa tttaaatggc atggtcatta gtgaagatac cgtttacaaa gttaccacag gcccaatatt ctctatggct ctccatccat cagaaactag aactttggta gcagttgggg ccaaatttgg gcaagttgga ctttgtgatt tgacccagca acctaaagaa gatggagttt atgtttttca tccccatagt cagccagtta gctgtcttta cttctcaccc gccaatccgg cccacatact gtcactgagc tatgatggca cgttacgctg tggggatttt tccagggcta tttttgaaga ggtgtataga aatgaaagaa gtagcttttc ctccttcgac ttcttggcag aagatgcctc cactttaata gtaggacact gggatggaaa tatgtcactg gtggatagac ggacacctgg aacttcttat gagaaactta ccagttcttc tatgggaaaa ataagaactg ttcatgtcca cccagtgcat agacagtatt ttatcactgc cggattgagg gatactcata tttatgatgc aaggcgattg aattccagga gaagtcagcc tttgatttct ttgactgaac atacaaagag cattgcttcc gcctattttt cacctcttac tggtaacaga gtggtgacca catgtgctga ttgtaatctg agaatttttg acagcagctg tatatcttct aagattccgc tcctcaccac catcaggcac aacactttca ctgggcgatg gctgaccagg ttccaagcca tgtgggatcc taaacaagaa gactgtgtca tagttggcag catggcccat ccacgacggg tagaaatctt ccatgagaca ggaaagaggg tgcattcgtt tggtggagaa taccttgtct ctgtgtgttc catcaatgcc atgcacccaa ctcggtatat tttggctgga ggtaattcca gcgggaagat acatgttttt atgaatgaaa aaagctgctg a. It is sometimes possible for the material contained within the vial of "WDR76, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

aaabiotech.com © 2012-2025

All rights reserved.

Contact us by

Tel: +1 (619) 604-9440 | Fax: +1 (619) 604-9440
contact@aaabiotech.com
Looking for a specific manual?
Request a Manual