Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WDR5 cdna clone

WDR5 cDNA Clone

Gene Names
WDR5; SWD3; BIG-3; CFAP89
Synonyms
WDR5; WDR5 cDNA Clone; WDR5 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgacggaggagaagaagcccgagaccgaggccgccagagcacagccaaccccttcgtcatccgccactcagagcaagcctacacctgtgaagccaaactatgctctaaagttcacccttgctggccacaccaaagcagtgtcctccgtgaaattcagcccgaatggagagtggctggcaagttcatctgctgataaacttattaaaatttggggcgcgtatgatgggaaatttgagaaaaccatatctggtcacaagctgggaatatccgatgtagcctggtcgtcagattctaaccttcttgtttctgcctcagatgacaaaaccttgaagatatgggacgtgagctcgggcaagtgtctgaaaaccctgaagggacacagtaattatgtcttttgctgcaacttcaatccccagtccaaccttattgtctcaggatcctttgacgaaagcgtgaggatatgggatgtgaaaacagggaagtgcctcaagactttgccagctcactcggatccagtctcggccgttcattttaatcgtgatggatccttgatagtttcaagtagctatgatggtctctgtcgcatctgggacaccgcctcgggccagtgcctgaagacgctcatcgatgacgacaacccccccgtgtcttttgtgaagttctccccgaacggcaaatacatcctggccgccacgctggacaacactctgaagctctgggactacagcaaggggaagtgcctgaagacgtacactggccacaagaatgagaaatactgcatatttgccaatttctctgttactggtgggaagtggattgtgtctggctcagaggataaccttgtttacatctggaaccttcagacgaaagagattgtacagaaactacaaggccacacagatgtcgtgatctcaacagcttgtcacccaacagaaaacatcatcgcctctgctgcgctagaaaatgacaaaacaattaaactgtggaagagtgactgctaa
Sequence Length
1005
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,588 Da
NCBI Official Full Name
Homo sapiens WD repeat domain 5, mRNA
NCBI Official Synonym Full Names
WD repeat domain 5
NCBI Official Symbol
WDR5
NCBI Official Synonym Symbols
SWD3; BIG-3; CFAP89
NCBI Protein Information
WD repeat-containing protein 5
UniProt Protein Name
WD repeat-containing protein 5
UniProt Gene Name
WDR5
UniProt Synonym Gene Names
BIG3
UniProt Entry Name
WDR5_HUMAN

NCBI Description

This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 7 WD repeats. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

WDR5: a WD40 repeat protein. May accelerate osteoblast differentiation. Interacts with HCFC1. WD40 repeats are found in a number of eukaryotic proteins that coordinate multi-protein complex assemblies. WD40 proteins are implicated in many functions including adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 9q34

Cellular Component: histone acetyltransferase complex; histone methyltransferase complex; nucleoplasm; nucleus

Molecular Function: histone acetyltransferase activity (H4-K16 specific); histone lysine N-methyltransferase activity (H3-K4 specific); histone-lysine N-methyltransferase activity; methylated histone residue binding; protein binding

Biological Process: histone H3-K4 methylation

Research Articles on WDR5

Similar Products

Product Notes

The WDR5 wdr5 (Catalog #AAA1275747) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgacgg aggagaagaa gcccgagacc gaggccgcca gagcacagcc aaccccttcg tcatccgcca ctcagagcaa gcctacacct gtgaagccaa actatgctct aaagttcacc cttgctggcc acaccaaagc agtgtcctcc gtgaaattca gcccgaatgg agagtggctg gcaagttcat ctgctgataa acttattaaa atttggggcg cgtatgatgg gaaatttgag aaaaccatat ctggtcacaa gctgggaata tccgatgtag cctggtcgtc agattctaac cttcttgttt ctgcctcaga tgacaaaacc ttgaagatat gggacgtgag ctcgggcaag tgtctgaaaa ccctgaaggg acacagtaat tatgtctttt gctgcaactt caatccccag tccaacctta ttgtctcagg atcctttgac gaaagcgtga ggatatggga tgtgaaaaca gggaagtgcc tcaagacttt gccagctcac tcggatccag tctcggccgt tcattttaat cgtgatggat ccttgatagt ttcaagtagc tatgatggtc tctgtcgcat ctgggacacc gcctcgggcc agtgcctgaa gacgctcatc gatgacgaca acccccccgt gtcttttgtg aagttctccc cgaacggcaa atacatcctg gccgccacgc tggacaacac tctgaagctc tgggactaca gcaaggggaa gtgcctgaag acgtacactg gccacaagaa tgagaaatac tgcatatttg ccaatttctc tgttactggt gggaagtgga ttgtgtctgg ctcagaggat aaccttgttt acatctggaa ccttcagacg aaagagattg tacagaaact acaaggccac acagatgtcg tgatctcaac agcttgtcac ccaacagaaa acatcatcgc ctctgctgcg ctagaaaatg acaaaacaat taaactgtgg aagagtgact gctaa. It is sometimes possible for the material contained within the vial of "WDR5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.