WDR31 cdna clone
WDR31 cDNA Clone
Synonyms
WDR31; WDR31 cDNA Clone; WDR31 cdna clone
Sequence
atgctgctactcaggtgccaactgaaacaagctcctccacagaaggtttcgtttaggttttgtgtcgtgatggggaaacagcaaagcaaactcaaacacagcacttataaatacgggcctgatgaaattatagaagagagaattcaaactaaagcttttcaagagtatagcccagctcacatggataccgtctctgtcgtggctgctttgaactcagacctttgtgtctctggagggaaagataagacagttgtggcctataattggaaaactggaaatgtggtgaaaaggttcaaaggacatgaacatgagatcaccaaggtagcctgtattcccaaatccagccagttcttcagtgcctctcgtgacaggatggtcatgatgtgggacttgcacggttcctcacaaccaaggcagcaattgtgtggccatgccatggtggtcaccggattggctgtgagtccagactcatcacagctgtgcactggctctcgggacaacaccctgcttctgtgggatgtggtgacaggacagagtgtggaaagagcatctgtctccaggaacgtggtcactcacctgtgctgggtccccagagaaccatacatactacagacctctgaagataaaaccctcagattatgggacagtcgggggctgcaggtagctcatatgtttcctgcaaagcagcacattcagacctactgtgaagtcagtgtggatggacacaagtgtatctcctgcagcaatggctttggaggagaaggctgtgaagccacgttgtgggacctaagacagactcgaaacagaatatgtgagtataaggggcatttccagactgtcgcatcctgcgtctttctaccaagagcattggccttgatgcctttaattgctacctcatcacatgattgcaaggtgaagatttggaaccaagatactggagcctgccttttcaccttgtctctggatggatcaggacccttgacttctctggctgttggtgacgccatctccttattgtgtgcaagttttaacagaggaattcacttactcagaatggaccacagccaagggctggaactgcaggaagtggcagcattctga
Sequence Length
1101
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
40,684 Da
NCBI Official Full Name
Homo sapiens WD repeat domain 31, mRNA
NCBI Official Synonym Full Names
WD repeat domain 31
NCBI Official Symbol
WDR31
NCBI Protein Information
WD repeat-containing protein 31
UniProt Protein Name
WD repeat-containing protein 31
Protein Family
UniProt Gene Name
WDR31
UniProt Entry Name
WDR31_HUMAN
NCBI Description
This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Uniprot Description
WDR31: 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 9q32
Research Articles on WDR31
Similar Products
Product Notes
The WDR31 wdr31 (Catalog #AAA1269060) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgctac tcaggtgcca actgaaacaa gctcctccac agaaggtttc gtttaggttt tgtgtcgtga tggggaaaca gcaaagcaaa ctcaaacaca gcacttataa atacgggcct gatgaaatta tagaagagag aattcaaact aaagcttttc aagagtatag cccagctcac atggataccg tctctgtcgt ggctgctttg aactcagacc tttgtgtctc tggagggaaa gataagacag ttgtggccta taattggaaa actggaaatg tggtgaaaag gttcaaagga catgaacatg agatcaccaa ggtagcctgt attcccaaat ccagccagtt cttcagtgcc tctcgtgaca ggatggtcat gatgtgggac ttgcacggtt cctcacaacc aaggcagcaa ttgtgtggcc atgccatggt ggtcaccgga ttggctgtga gtccagactc atcacagctg tgcactggct ctcgggacaa caccctgctt ctgtgggatg tggtgacagg acagagtgtg gaaagagcat ctgtctccag gaacgtggtc actcacctgt gctgggtccc cagagaacca tacatactac agacctctga agataaaacc ctcagattat gggacagtcg ggggctgcag gtagctcata tgtttcctgc aaagcagcac attcagacct actgtgaagt cagtgtggat ggacacaagt gtatctcctg cagcaatggc tttggaggag aaggctgtga agccacgttg tgggacctaa gacagactcg aaacagaata tgtgagtata aggggcattt ccagactgtc gcatcctgcg tctttctacc aagagcattg gccttgatgc ctttaattgc tacctcatca catgattgca aggtgaagat ttggaaccaa gatactggag cctgcctttt caccttgtct ctggatggat caggaccctt gacttctctg gctgttggtg acgccatctc cttattgtgt gcaagtttta acagaggaat tcacttactc agaatggacc acagccaagg gctggaactg caggaagtgg cagcattctg a. It is sometimes possible for the material contained within the vial of "WDR31, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
