Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WDR20 cdna clone

WDR20 cDNA Clone

Gene Names
WDR20; DMR
Synonyms
WDR20; WDR20 cDNA Clone; WDR20 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgacggagggaggagggaaggagatgaacgagattaagacccaattcaccacccgggaaggtctgtacaagctgctgccgcactcggagtacagccggcccaaccgggtgcccttcaactcgcagggatccaaccctgtccgcgtctccttcgtaaacctcaacgaccagtctggcaacggcgaccgcctctgcttcaatgtgggccgggagctgtacttctatatctacaagggggtccgcaaggctgctgacttgagtaaaccaatagataaaaggatatacaaaggaacacagcctacttgtcatgacttcaaccacctaacagccacagcagaaagtgtctctctcctagtgggcttttccgcaggccaagtccagcttatagacccaatcaaaaaagaaactagcaaactttttaatgaggaaaactcttgtcagcacttgtggaaggtggattggaatgaagaaagacagaatgaaggtagcaagaccagtgaggaggctctagtaactgtccagccggcagagcacttctgcaggcaggaggacaggatgcaaggtgttctccaagaccagaactaa
Sequence Length
588
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
9,820 Da
NCBI Official Full Name
Homo sapiens WD repeat domain 20, mRNA
NCBI Official Synonym Full Names
WD repeat domain 20
NCBI Official Symbol
WDR20
NCBI Official Synonym Symbols
DMR
NCBI Protein Information
WD repeat-containing protein 20
UniProt Protein Name
WD repeat-containing protein 20
UniProt Gene Name
WDR20
UniProt Entry Name
WDR20_HUMAN

NCBI Description

This gene encodes a WD repeat-containing protein that functions to preserve and regulate the activity of the USP12-UAF1 deubiquitinating enzyme complex. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2011]

Uniprot Description

WDR20: a WD40 repeat protein. WD40 repeats are found in a number of eukaryotic proteins that coordinate multi-protein complex assemblies. WD40 proteins are implicated in many functions including adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 14q32.31

Molecular Function: protein binding

Research Articles on WDR20

Similar Products

Product Notes

The WDR20 wdr20 (Catalog #AAA1277815) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgacgg agggaggagg gaaggagatg aacgagatta agacccaatt caccacccgg gaaggtctgt acaagctgct gccgcactcg gagtacagcc ggcccaaccg ggtgcccttc aactcgcagg gatccaaccc tgtccgcgtc tccttcgtaa acctcaacga ccagtctggc aacggcgacc gcctctgctt caatgtgggc cgggagctgt acttctatat ctacaagggg gtccgcaagg ctgctgactt gagtaaacca atagataaaa ggatatacaa aggaacacag cctacttgtc atgacttcaa ccacctaaca gccacagcag aaagtgtctc tctcctagtg ggcttttccg caggccaagt ccagcttata gacccaatca aaaaagaaac tagcaaactt tttaatgagg aaaactcttg tcagcacttg tggaaggtgg attggaatga agaaagacag aatgaaggta gcaagaccag tgaggaggct ctagtaactg tccagccggc agagcacttc tgcaggcagg aggacaggat gcaaggtgtt ctccaagacc agaactaa. It is sometimes possible for the material contained within the vial of "WDR20, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.