WDR16 cdna clone
WDR16 cDNA Clone
Gene Names
CFAP52; WDR16; WDRPUH
Synonyms
WDR16; WDR16 cDNA Clone; WDR16 cdna clone
Sequence
atggataacaaaatttcgccggaggcccaagtggcggagctggaacttgacgccgtgatcggcttcaatggacatgtgcccactggtctcaaatgccatcctgaccaggagcatatgatttatcctcttggttgcacagtcctcattcaggcaataaatactaaagagcagaacttcctacagggtcatggcaacaacgtctcctgcttggccatctccaggtctggagagtacatcgcctccggacaagtcacattcatggggttcaaggtagacatcattttgtgggattataagaacagagagctgcttgctcggctgtcccttcacaaaggcaaaattgaagctctggccttttctccaaatgatttgtacttggtatcactaggaggcccagatgacggaagtgtggtggtgtggagcatagccaagagagatgccatctgtggcagccctgcagccggcctcaatgttggcaatgccaccaatgtgatcttctccaggtgccgggatgagatgtttatgactgctggaaatgggacaattcgagtatgggaattggatcttccaaatagaaaaatctggccaactgagagccaaacaggacagttgaaaagaatagtcatgagtattggagtggatgatgatgatagctttttctaccttggcaccacgactggagatattctaaaaatgaaccccaggactaaactgctgacagatgttgggcctgcgaaggacaaattcagtttgggagtgtcagctatcaggtgcctgaagatggggggtttgttggtgggctctggagccggactgctggtcttctgtaaaagccctggctacaaacccatcaagaagattcagttacaaggcggcatcacttctatcacacttcgaggagaaggacaccagtttctcgtaggaacagaagaatcgcacatttatcgtgtcagcttcacggatttcaaagagacgctcatagcgacttgtcactttgatgctgtcaaggatattgtctttccatttggcactgctgagctatttgcaacctgtgccaagaaggatatcagggtgtggcacacatcatccaacagggagctgctgcggatcaccgtgcccaacatgacctgccacggcatcgacttcatgagggacggcaaaagcatcatttcagcatggaacgacggtaaaatccgagccttcgccccagagacaggccgactgatgtatgtcattaacaatgctcacaggatcggcgtcaccgccatcgccaccaccagtgactgtaaaagggtcatcagtggcggtggggaaggggaggtgagggtatggcagataggctgtcagacccagaagctggaggaggccctgaaggaacacaagtcatcagtgtcctgcattagggtgaagaggaacaacgaggagtgtgtcaccgccagcaccgatgggacttgtatcatttgggaccttgtgcgtctcaggaggaatcagatgatactagccaacaccttattccagtgtgtgtgctatcaccctgaggagttccagatcatcaccagcggaacagacagaaagattgcttactgggaagtatttgatgggacagtaatcagagaattggaaggttccctgtctgggtcgataaatggcatggatatcacacaggaaggggtgcactttgtcacaggtggaaatgaccatctggtcaaagtttgggattataatgagggtgaagtgactcacgttggggtgggacacagtggcaacatcacacgcatccgcataagtccaggaaatcaatatattgttagtgtaagtgccgatggagccattttgcgatggaagtacccatatacctcctga
Sequence Length
1863
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
60,957 Da
NCBI Official Full Name
Homo sapiens WD repeat domain 16, mRNA
NCBI Official Synonym Full Names
cilia and flagella associated protein 52
NCBI Official Symbol
CFAP52
NCBI Official Synonym Symbols
WDR16; WDRPUH
NCBI Protein Information
cilia- and flagella-associated protein 52
UniProt Protein Name
Cilia- and flagella-associated protein 52
UniProt Gene Name
CFAP52
UniProt Entry Name
CFA52_HUMAN
NCBI Description
WD repeat-containing proteins, such as WDR16, play crucial roles in a wide range of physiologic functions, including signal transduction, RNA processing, remodeling the cytoskeleton, regulation of vesicular traffic, and cell division (Silva et al., 2005 [PubMed 15967112]).[supplied by OMIM, Mar 2008]
Uniprot Description
WDR16: a cytoplasmic WD40 repeat protein. May play a role in the growth or survival of hepatocellular carcinoma. WD40 repeats are found in a number of eukaryotic proteins that coordinate multi-protein complex assemblies. WD40 proteins are implicated in many functions including adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly. Three alternatively spliced human isoforms have been described.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 17p13.1
Molecular Function: protein binding
Research Articles on WDR16
Similar Products
Product Notes
The WDR16 cfap52 (Catalog #AAA1266694) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggataaca aaatttcgcc ggaggcccaa gtggcggagc tggaacttga cgccgtgatc ggcttcaatg gacatgtgcc cactggtctc aaatgccatc ctgaccagga gcatatgatt tatcctcttg gttgcacagt cctcattcag gcaataaata ctaaagagca gaacttccta cagggtcatg gcaacaacgt ctcctgcttg gccatctcca ggtctggaga gtacatcgcc tccggacaag tcacattcat ggggttcaag gtagacatca ttttgtggga ttataagaac agagagctgc ttgctcggct gtcccttcac aaaggcaaaa ttgaagctct ggccttttct ccaaatgatt tgtacttggt atcactagga ggcccagatg acggaagtgt ggtggtgtgg agcatagcca agagagatgc catctgtggc agccctgcag ccggcctcaa tgttggcaat gccaccaatg tgatcttctc caggtgccgg gatgagatgt ttatgactgc tggaaatggg acaattcgag tatgggaatt ggatcttcca aatagaaaaa tctggccaac tgagagccaa acaggacagt tgaaaagaat agtcatgagt attggagtgg atgatgatga tagctttttc taccttggca ccacgactgg agatattcta aaaatgaacc ccaggactaa actgctgaca gatgttgggc ctgcgaagga caaattcagt ttgggagtgt cagctatcag gtgcctgaag atggggggtt tgttggtggg ctctggagcc ggactgctgg tcttctgtaa aagccctggc tacaaaccca tcaagaagat tcagttacaa ggcggcatca cttctatcac acttcgagga gaaggacacc agtttctcgt aggaacagaa gaatcgcaca tttatcgtgt cagcttcacg gatttcaaag agacgctcat agcgacttgt cactttgatg ctgtcaagga tattgtcttt ccatttggca ctgctgagct atttgcaacc tgtgccaaga aggatatcag ggtgtggcac acatcatcca acagggagct gctgcggatc accgtgccca acatgacctg ccacggcatc gacttcatga gggacggcaa aagcatcatt tcagcatgga acgacggtaa aatccgagcc ttcgccccag agacaggccg actgatgtat gtcattaaca atgctcacag gatcggcgtc accgccatcg ccaccaccag tgactgtaaa agggtcatca gtggcggtgg ggaaggggag gtgagggtat ggcagatagg ctgtcagacc cagaagctgg aggaggccct gaaggaacac aagtcatcag tgtcctgcat tagggtgaag aggaacaacg aggagtgtgt caccgccagc accgatggga cttgtatcat ttgggacctt gtgcgtctca ggaggaatca gatgatacta gccaacacct tattccagtg tgtgtgctat caccctgagg agttccagat catcaccagc ggaacagaca gaaagattgc ttactgggaa gtatttgatg ggacagtaat cagagaattg gaaggttccc tgtctgggtc gataaatggc atggatatca cacaggaagg ggtgcacttt gtcacaggtg gaaatgacca tctggtcaaa gtttgggatt ataatgaggg tgaagtgact cacgttgggg tgggacacag tggcaacatc acacgcatcc gcataagtcc aggaaatcaa tatattgtta gtgtaagtgc cgatggagcc attttgcgat ggaagtaccc atatacctcc tga. It is sometimes possible for the material contained within the vial of "WDR16, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
