Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WDFY3 cdna clone

WDFY3 cDNA Clone

Gene Names
WDFY3; ALFY; ZFYVE25
Synonyms
WDFY3; WDFY3 cDNA Clone; WDFY3 cdna clone
Ordering
For Research Use Only!
Sequence
atggaatttttgcaagttcctgaaacaccagctcctgagcctgctgaagtcctagaaatgcaggaagactgtccagaagcacaaatagggcaggaagcccaagacgaggacagcagtgattcagaagcagatgagcagagcatcagccaggaccctaaggacactccaagccaacccagcagcaccagccacaggccccgggcagcctcctgccgcgcaacagccgcctggtgtactgacagtggctctgacgactccagacgctggtccgaccagctcagtctagatgagaaagacggcttcatatttgtgaactattcagagggccagaccagagcccatctgcagggcccccttagccacccccaccccaatcccattgaggtgcggaattacagcagattgaaacctgggtaccgatgggaacggcagctggtgttcaggagtaagctgactatgcacacagcctttgatcgaaaggacaatgcacacccagctgaggtcactgccttgggcatctccaaggatcacagtaggatcctcgttggtgacagtcgaggccgagttttcagctggtctgtgagtgaccagccaggccgttctgctgctgatcactgggtgaaggatgaaggtggtgacagctgctcaggctgctcggtgaggttttcactcacagaaagacgacaccattgcaggaactgcggtcagctcttctgccagaagtgcagtcgctttcaatctgaaatcaaacgcttgaaaatctcatccccggtgcgtgtttgtcagaactgttattataacttacagcatgagagaggttcagaagatgggcctcgaaattgttga
Sequence Length
846
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
393,367 Da
NCBI Official Full Name
Homo sapiens WD repeat and FYVE domain containing 3, mRNA
NCBI Official Synonym Full Names
WD repeat and FYVE domain containing 3
NCBI Official Symbol
WDFY3
NCBI Official Synonym Symbols
ALFY; ZFYVE25
NCBI Protein Information
WD repeat and FYVE domain-containing protein 3
UniProt Protein Name
WD repeat and FYVE domain-containing protein 3
UniProt Gene Name
WDFY3
UniProt Synonym Gene Names
KIAA0993; Alfy
UniProt Entry Name
WDFY3_HUMAN

NCBI Description

This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]

Uniprot Description

WDFY3: 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Nuclear envelope; Lipid-binding; Transferase; Membrane protein, peripheral

Chromosomal Location of Human Ortholog: 4q21.23

Cellular Component: autophagic vacuole; cytoplasm; extrinsic to membrane; inclusion body; nuclear envelope; PML body

Molecular Function: phosphatidylinositol binding; protein binding

Research Articles on WDFY3

Similar Products

Product Notes

The WDFY3 wdfy3 (Catalog #AAA1267158) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaatttt tgcaagttcc tgaaacacca gctcctgagc ctgctgaagt cctagaaatg caggaagact gtccagaagc acaaataggg caggaagccc aagacgagga cagcagtgat tcagaagcag atgagcagag catcagccag gaccctaagg acactccaag ccaacccagc agcaccagcc acaggccccg ggcagcctcc tgccgcgcaa cagccgcctg gtgtactgac agtggctctg acgactccag acgctggtcc gaccagctca gtctagatga gaaagacggc ttcatatttg tgaactattc agagggccag accagagccc atctgcaggg cccccttagc cacccccacc ccaatcccat tgaggtgcgg aattacagca gattgaaacc tgggtaccga tgggaacggc agctggtgtt caggagtaag ctgactatgc acacagcctt tgatcgaaag gacaatgcac acccagctga ggtcactgcc ttgggcatct ccaaggatca cagtaggatc ctcgttggtg acagtcgagg ccgagttttc agctggtctg tgagtgacca gccaggccgt tctgctgctg atcactgggt gaaggatgaa ggtggtgaca gctgctcagg ctgctcggtg aggttttcac tcacagaaag acgacaccat tgcaggaact gcggtcagct cttctgccag aagtgcagtc gctttcaatc tgaaatcaaa cgcttgaaaa tctcatcccc ggtgcgtgtt tgtcagaact gttattataa cttacagcat gagagaggtt cagaagatgg gcctcgaaat tgttga. It is sometimes possible for the material contained within the vial of "WDFY3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.